Incidental Mutation 'R8400:Nlrp9b'
ID 647808
Institutional Source Beutler Lab
Gene Symbol Nlrp9b
Ensembl Gene ENSMUSG00000060508
Gene Name NLR family, pyrin domain containing 9B
Synonyms Nalp9b, Nalp-delta
MMRRC Submission 067763-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 19725318-19796867 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 19757937 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 391 (C391*)
Ref Sequence ENSEMBL: ENSMUSP00000072895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073151] [ENSMUST00000117909] [ENSMUST00000137183] [ENSMUST00000207805]
AlphaFold Q66X22
Predicted Effect probably null
Transcript: ENSMUST00000073151
AA Change: C391*
SMART Domains Protein: ENSMUSP00000072895
Gene: ENSMUSG00000060508
AA Change: C391*

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 311 4.3e-34 PFAM
low complexity region 580 595 N/A INTRINSIC
LRR 630 657 2.16e2 SMART
LRR 691 718 2.23e2 SMART
LRR 747 774 6.67e-2 SMART
LRR 776 803 3.65e0 SMART
LRR 804 831 5.59e-4 SMART
LRR 833 860 2.81e0 SMART
LRR 861 888 8.87e-7 SMART
LRR 890 917 9.24e1 SMART
Blast:LRR 918 945 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117909
SMART Domains Protein: ENSMUSP00000113762
Gene: ENSMUSG00000060508

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 179 2.8e-6 PFAM
LRR 190 217 2.16e2 SMART
LRR 251 278 2.23e2 SMART
LRR 307 334 6.67e-2 SMART
LRR 336 363 3.65e0 SMART
LRR 364 391 5.59e-4 SMART
LRR 393 420 2.81e0 SMART
Pfam:Chromo_shadow 450 501 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137183
SMART Domains Protein: ENSMUSP00000115158
Gene: ENSMUSG00000060508

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 240 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207805
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
PHENOTYPE: The protein protects against rotavirus infection. Homozygous KO leads to increased susceptibility to infection and greater severity of pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,243,925 (GRCm39) M1929I probably benign Het
Abca13 T C 11: 9,248,218 (GRCm39) I2655T probably damaging Het
Acad10 A G 5: 121,764,268 (GRCm39) V887A possibly damaging Het
Acot10 T C 15: 20,666,258 (GRCm39) E161G possibly damaging Het
Astn1 C T 1: 158,484,670 (GRCm39) P919L probably benign Het
Atp1a4 T A 1: 172,062,061 (GRCm39) D688V probably damaging Het
C4bp C A 1: 130,564,484 (GRCm39) C400F probably damaging Het
Col6a6 A C 9: 105,651,995 (GRCm39) D1005E probably damaging Het
Csnk1g3 C T 18: 54,086,360 (GRCm39) R422C probably benign Het
Cutc T C 19: 43,741,644 (GRCm39) S15P probably benign Het
Dgkb T C 12: 38,652,837 (GRCm39) probably null Het
Disc1 T C 8: 125,959,732 (GRCm39) V748A probably benign Het
Dmbt1 C G 7: 130,684,317 (GRCm39) D778E unknown Het
Dmxl2 T C 9: 54,291,037 (GRCm39) Y2471C probably benign Het
Fam185a T A 5: 21,643,814 (GRCm39) N243K probably benign Het
Fchsd2 A T 7: 100,902,780 (GRCm39) Q386L possibly damaging Het
Gm904 C A 13: 50,797,453 (GRCm39) P49Q probably damaging Het
H2-Q10 C T 17: 35,781,374 (GRCm39) R59C probably damaging Het
Ier5l A G 2: 30,363,105 (GRCm39) Y307H possibly damaging Het
Kmt2e C A 5: 23,702,090 (GRCm39) T906K probably benign Het
Kndc1 C T 7: 139,493,434 (GRCm39) R467W probably damaging Het
Muc5ac C A 7: 141,364,213 (GRCm39) T2508K probably damaging Het
Nlrp9a A T 7: 26,264,431 (GRCm39) M784L probably benign Het
Nubp2 A C 17: 25,103,439 (GRCm39) M146R probably damaging Het
Or10q3 T A 19: 11,848,578 (GRCm39) M1L probably damaging Het
Or1a1b C T 11: 74,097,221 (GRCm39) V274M possibly damaging Het
Or2ag1b T A 7: 106,288,876 (GRCm39) S21C probably benign Het
Or2b2 G A 13: 21,888,085 (GRCm39) V305M probably benign Het
Or4k45 A T 2: 111,395,747 (GRCm39) L14H probably damaging Het
Or7e166 A T 9: 19,624,389 (GRCm39) N89Y probably benign Het
Otud1 T C 2: 19,663,189 (GRCm39) V106A possibly damaging Het
Pcdhac1 T A 18: 37,225,453 (GRCm39) Y755* probably null Het
Pkd1l3 C T 8: 110,350,520 (GRCm39) P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,119,477 (GRCm39) probably benign Het
Samhd1 T C 2: 156,941,353 (GRCm39) E648G probably benign Het
Smarca5 T C 8: 81,435,756 (GRCm39) T794A probably benign Het
Spc24 A T 9: 21,669,026 (GRCm39) L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Stra6l G A 4: 45,864,905 (GRCm39) R77Q probably damaging Het
Tdrd1 G A 19: 56,837,081 (GRCm39) V472M probably benign Het
Tsc2 A T 17: 24,823,961 (GRCm39) I948K possibly damaging Het
Ttc39d T C 17: 80,523,434 (GRCm39) V31A probably benign Het
Vmn1r158 A T 7: 22,489,305 (GRCm39) C301* probably null Het
Vmn2r22 A T 6: 123,614,486 (GRCm39) L368* probably null Het
Vmn2r79 A G 7: 86,651,308 (GRCm39) T236A probably benign Het
Vwa1 T C 4: 155,857,225 (GRCm39) H191R probably benign Het
Zdbf2 T A 1: 63,344,135 (GRCm39) V838E possibly damaging Het
Other mutations in Nlrp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Nlrp9b APN 7 19,757,203 (GRCm39) missense probably benign 0.43
IGL00675:Nlrp9b APN 7 19,757,111 (GRCm39) missense possibly damaging 0.63
IGL00755:Nlrp9b APN 7 19,757,447 (GRCm39) missense probably damaging 1.00
IGL01131:Nlrp9b APN 7 19,757,462 (GRCm39) missense probably damaging 1.00
IGL01134:Nlrp9b APN 7 19,757,112 (GRCm39) missense probably benign 0.06
IGL01464:Nlrp9b APN 7 19,796,580 (GRCm39) missense probably benign 0.00
IGL01514:Nlrp9b APN 7 19,779,859 (GRCm39) critical splice donor site probably null
IGL01731:Nlrp9b APN 7 19,757,342 (GRCm39) nonsense probably null
IGL02427:Nlrp9b APN 7 19,776,426 (GRCm39) missense probably damaging 1.00
IGL03013:Nlrp9b APN 7 19,782,750 (GRCm39) missense probably damaging 1.00
R0037:Nlrp9b UTSW 7 19,757,647 (GRCm39) missense probably damaging 0.99
R0114:Nlrp9b UTSW 7 19,757,981 (GRCm39) missense probably benign 0.00
R0276:Nlrp9b UTSW 7 19,762,423 (GRCm39) missense probably benign 0.21
R0346:Nlrp9b UTSW 7 19,758,440 (GRCm39) missense probably damaging 0.99
R0736:Nlrp9b UTSW 7 19,783,375 (GRCm39) missense probably damaging 1.00
R1449:Nlrp9b UTSW 7 19,757,089 (GRCm39) missense possibly damaging 0.91
R1540:Nlrp9b UTSW 7 19,782,772 (GRCm39) nonsense probably null
R1648:Nlrp9b UTSW 7 19,760,469 (GRCm39) missense possibly damaging 0.89
R1878:Nlrp9b UTSW 7 19,762,489 (GRCm39) missense probably benign 0.01
R1903:Nlrp9b UTSW 7 19,757,182 (GRCm39) missense probably benign 0.44
R2191:Nlrp9b UTSW 7 19,757,587 (GRCm39) missense probably benign
R4572:Nlrp9b UTSW 7 19,760,606 (GRCm39) critical splice donor site probably null
R4863:Nlrp9b UTSW 7 19,783,521 (GRCm39) critical splice donor site probably null
R4939:Nlrp9b UTSW 7 19,758,421 (GRCm39) missense probably damaging 0.99
R5211:Nlrp9b UTSW 7 19,783,381 (GRCm39) missense probably damaging 1.00
R5329:Nlrp9b UTSW 7 19,757,916 (GRCm39) missense probably damaging 1.00
R5580:Nlrp9b UTSW 7 19,757,089 (GRCm39) missense probably damaging 0.98
R5696:Nlrp9b UTSW 7 19,758,417 (GRCm39) missense probably benign 0.02
R6265:Nlrp9b UTSW 7 19,796,608 (GRCm39) missense probably benign
R6456:Nlrp9b UTSW 7 19,782,703 (GRCm39) missense probably damaging 1.00
R6672:Nlrp9b UTSW 7 19,753,263 (GRCm39) missense probably damaging 1.00
R6750:Nlrp9b UTSW 7 19,757,159 (GRCm39) nonsense probably null
R6896:Nlrp9b UTSW 7 19,757,170 (GRCm39) missense probably damaging 0.96
R6968:Nlrp9b UTSW 7 19,783,433 (GRCm39) missense probably damaging 1.00
R7108:Nlrp9b UTSW 7 19,779,855 (GRCm39) missense probably damaging 1.00
R7287:Nlrp9b UTSW 7 19,762,381 (GRCm39) missense probably damaging 0.97
R7297:Nlrp9b UTSW 7 19,783,438 (GRCm39) missense possibly damaging 0.81
R7485:Nlrp9b UTSW 7 19,757,875 (GRCm39) missense probably damaging 1.00
R7552:Nlrp9b UTSW 7 19,779,691 (GRCm39) missense probably benign 0.04
R7573:Nlrp9b UTSW 7 19,753,125 (GRCm39) missense probably damaging 1.00
R7690:Nlrp9b UTSW 7 19,758,295 (GRCm39) missense probably benign 0.00
R7839:Nlrp9b UTSW 7 19,758,398 (GRCm39) missense possibly damaging 0.49
R7913:Nlrp9b UTSW 7 19,779,725 (GRCm39) missense probably benign 0.07
R7968:Nlrp9b UTSW 7 19,762,493 (GRCm39) missense probably benign 0.01
R8113:Nlrp9b UTSW 7 19,753,260 (GRCm39) missense probably benign 0.02
R8273:Nlrp9b UTSW 7 19,757,986 (GRCm39) missense possibly damaging 0.89
R9047:Nlrp9b UTSW 7 19,757,401 (GRCm39) missense possibly damaging 0.80
R9224:Nlrp9b UTSW 7 19,757,476 (GRCm39) missense probably benign 0.44
R9224:Nlrp9b UTSW 7 19,753,217 (GRCm39) missense probably benign 0.00
R9291:Nlrp9b UTSW 7 19,758,511 (GRCm39) missense possibly damaging 0.80
R9348:Nlrp9b UTSW 7 19,757,336 (GRCm39) missense probably damaging 1.00
R9398:Nlrp9b UTSW 7 19,783,435 (GRCm39) missense probably damaging 1.00
R9442:Nlrp9b UTSW 7 19,779,707 (GRCm39) missense possibly damaging 0.84
R9495:Nlrp9b UTSW 7 19,760,462 (GRCm39) missense possibly damaging 0.64
R9598:Nlrp9b UTSW 7 19,753,302 (GRCm39) missense probably benign 0.17
R9757:Nlrp9b UTSW 7 19,782,617 (GRCm39) missense probably damaging 1.00
X0064:Nlrp9b UTSW 7 19,782,683 (GRCm39) missense probably damaging 1.00
Z1088:Nlrp9b UTSW 7 19,757,668 (GRCm39) missense probably benign 0.01
Z1177:Nlrp9b UTSW 7 19,760,571 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGCAATCCTTATCTATGCTG -3'
(R):5'- TTCCAATGACTGGGACACATATG -3'

Sequencing Primer
(F):5'- GCAATCCTTATCTATGCTGGATGTTC -3'
(R):5'- CTTGTTTGAGGAAATAGAACATGGC -3'
Posted On 2020-09-02