Incidental Mutation 'R8400:Vmn1r158'
ID647809
Institutional Source Beutler Lab
Gene Symbol Vmn1r158
Ensembl Gene ENSMUSG00000094700
Gene Namevomeronasal 1 receptor 158
SynonymsGm16455
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R8400 (G1)
Quality Score108.008
Status Not validated
Chromosome7
Chromosomal Location22789859-22790782 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 22789880 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 301 (C301*)
Ref Sequence ENSEMBL: ENSMUSP00000133990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174643]
Predicted Effect probably null
Transcript: ENSMUST00000174643
AA Change: C301*
SMART Domains Protein: ENSMUSP00000133990
Gene: ENSMUSG00000094700
AA Change: C301*

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 2.9e-15 PFAM
Pfam:7tm_1 39 290 5.5e-9 PFAM
Pfam:V1R 41 298 3.2e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
C4bp C A 1: 130,636,747 C400F probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Csnk1g3 C T 18: 53,953,288 R422C probably benign Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
H2-Q10 C T 17: 35,470,477 R59C probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr1419 T A 19: 11,871,214 M1L probably damaging Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Samhd1 T C 2: 157,099,433 E648G probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Spc24 A T 9: 21,757,730 L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stra6l G A 4: 45,864,905 R77Q probably damaging Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Ttc39d T C 17: 80,216,005 V31A probably benign Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vmn2r79 A G 7: 87,002,100 T236A probably benign Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in Vmn1r158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vmn1r158 APN 7 22790779 missense probably benign 0.01
R1173:Vmn1r158 UTSW 7 22790445 missense probably benign 0.19
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1725:Vmn1r158 UTSW 7 22790647 missense probably benign 0.08
R1777:Vmn1r158 UTSW 7 22790430 missense probably damaging 1.00
R1813:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R1896:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R2077:Vmn1r158 UTSW 7 22790390 missense probably benign 0.03
R3749:Vmn1r158 UTSW 7 22790214 missense probably damaging 1.00
R4872:Vmn1r158 UTSW 7 22790754 missense possibly damaging 0.94
R5238:Vmn1r158 UTSW 7 22790374 missense probably benign
R6500:Vmn1r158 UTSW 7 22790653 missense possibly damaging 0.89
R6511:Vmn1r158 UTSW 7 22790691 missense probably benign 0.00
R6581:Vmn1r158 UTSW 7 22790040 missense possibly damaging 0.69
R6751:Vmn1r158 UTSW 7 22789881 missense probably damaging 0.96
R7168:Vmn1r158 UTSW 7 22790676 missense possibly damaging 0.82
R7337:Vmn1r158 UTSW 7 22790224 missense probably benign 0.00
R7747:Vmn1r158 UTSW 7 22790300 missense probably benign 0.15
R7902:Vmn1r158 UTSW 7 22790008 missense possibly damaging 0.67
R8328:Vmn1r158 UTSW 7 22790062 missense probably damaging 1.00
Z1177:Vmn1r158 UTSW 7 22790458 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCACTTACCATGTCAATCAGATTCC -3'
(R):5'- TATCCTGATGCTGGTGGTCAC -3'

Sequencing Primer
(F):5'- TACCATGTCAATCAGATTCCAAACAG -3'
(R):5'- CCTGATGCTGGTGGTCACATTTG -3'
Posted On2020-09-02