Incidental Mutation 'R8400:Vmn2r79'
ID 647811
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Name vomeronasal 2, receptor 79
Synonyms EG621430
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 86996465-87037968 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87002100 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 236 (T236A)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
AlphaFold E9Q067
Predicted Effect probably benign
Transcript: ENSMUST00000164462
AA Change: T236A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: T236A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
C4bp C A 1: 130,636,747 C400F probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Csnk1g3 C T 18: 53,953,288 R422C probably benign Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
H2-Q10 C T 17: 35,470,477 R59C probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr1419 T A 19: 11,871,214 M1L probably damaging Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Samhd1 T C 2: 157,099,433 E648G probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Spc24 A T 9: 21,757,730 L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stra6l G A 4: 45,864,905 R77Q probably damaging Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Ttc39d T C 17: 80,216,005 V31A probably benign Het
Vmn1r158 A T 7: 22,789,880 C301* probably null Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87037273 missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86996648 missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87002158 missense probably benign
IGL01834:Vmn2r79 APN 7 87037146 missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87037277 missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87037363 missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87037082 missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87002536 missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87004158 missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 87003591 missense probably benign 0.00
PIT4445001:Vmn2r79 UTSW 7 87002200 missense possibly damaging 0.46
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87003386 missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87002079 missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87002403 missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87003473 missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87004099 missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87037794 missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87037444 missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87004039 critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87037834 missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87002631 missense probably benign
R1781:Vmn2r79 UTSW 7 87002347 missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87001413 missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87037872 missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87004081 missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86996631 missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87002037 missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87002194 missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87003593 missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87002416 missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 87037960 missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 87001467 missense probably benign
R5016:Vmn2r79 UTSW 7 87037340 missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87002215 missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 87001969 missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87002570 missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87037157 missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87037768 missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 87001314 missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 87002290 missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87002044 missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87003533 missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 87004162 missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 87037372 missense probably benign
R6965:Vmn2r79 UTSW 7 87001892 missense probably benign 0.10
R7130:Vmn2r79 UTSW 7 87002266 missense probably damaging 0.99
R7156:Vmn2r79 UTSW 7 87037643 missense probably damaging 0.98
R7604:Vmn2r79 UTSW 7 87003384 critical splice acceptor site probably null
R7691:Vmn2r79 UTSW 7 87037903 missense probably damaging 0.96
R8055:Vmn2r79 UTSW 7 87037333 missense possibly damaging 0.94
R8070:Vmn2r79 UTSW 7 87002128 missense probably benign
R8073:Vmn2r79 UTSW 7 87002254 missense probably benign 0.00
R8145:Vmn2r79 UTSW 7 87037654 missense probably benign 0.02
R8263:Vmn2r79 UTSW 7 87037518 missense possibly damaging 0.89
R8350:Vmn2r79 UTSW 7 87037533 nonsense probably null
R8814:Vmn2r79 UTSW 7 87002506 missense probably benign 0.00
R8862:Vmn2r79 UTSW 7 86996504 missense probably benign 0.23
R9146:Vmn2r79 UTSW 7 87001473 nonsense probably null
R9276:Vmn2r79 UTSW 7 87037837 missense probably damaging 1.00
R9361:Vmn2r79 UTSW 7 87003614 critical splice donor site probably null
R9676:Vmn2r79 UTSW 7 87037244 missense probably damaging 1.00
U15987:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87004062 missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87002341 missense probably damaging 1.00
Z1176:Vmn2r79 UTSW 7 87002318 missense probably benign 0.00
Z1176:Vmn2r79 UTSW 7 87037169 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCTACCAGATGACTCCCAAG -3'
(R):5'- TCCATGCACAGAGTTAAGCATG -3'

Sequencing Primer
(F):5'- GATGACTCCCAAGGACACATCTC -3'
(R):5'- CCATGCACAGAGTTAAGCATGAATTC -3'
Posted On 2020-09-02