Incidental Mutation 'R8400:Spc24'
ID 647821
Institutional Source Beutler Lab
Gene Symbol Spc24
Ensembl Gene ENSMUSG00000074476
Gene Name SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms 2410030K01Rik, Spbc24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 21755442-21760303 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 21757730 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 87 (L87H)
Ref Sequence ENSEMBL: ENSMUSP00000096541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098942] [ENSMUST00000214149] [ENSMUST00000216057] [ENSMUST00000217382]
AlphaFold Q9D083
Predicted Effect probably damaging
Transcript: ENSMUST00000098942
AA Change: L87H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096541
Gene: ENSMUSG00000074476
AA Change: L87H

DomainStartEndE-ValueType
Pfam:Spc24 75 192 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214149
Predicted Effect probably damaging
Transcript: ENSMUST00000216057
AA Change: L87H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217382
AA Change: L87H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
C4bp C A 1: 130,636,747 C400F probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Csnk1g3 C T 18: 53,953,288 R422C probably benign Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
H2-Q10 C T 17: 35,470,477 R59C probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr1419 T A 19: 11,871,214 M1L probably damaging Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Samhd1 T C 2: 157,099,433 E648G probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stra6l G A 4: 45,864,905 R77Q probably damaging Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Ttc39d T C 17: 80,216,005 V31A probably benign Het
Vmn1r158 A T 7: 22,789,880 C301* probably null Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vmn2r79 A G 7: 87,002,100 T236A probably benign Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in Spc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0331:Spc24 UTSW 9 21757313 missense possibly damaging 0.74
R3026:Spc24 UTSW 9 21756215 makesense probably null
R3027:Spc24 UTSW 9 21756215 makesense probably null
R3028:Spc24 UTSW 9 21756215 makesense probably null
R4231:Spc24 UTSW 9 21756202 splice site probably null
R4233:Spc24 UTSW 9 21756202 splice site probably null
R4236:Spc24 UTSW 9 21756202 splice site probably null
R5635:Spc24 UTSW 9 21757390 missense probably damaging 0.99
R7371:Spc24 UTSW 9 21757368 missense probably damaging 1.00
R8892:Spc24 UTSW 9 21757698 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTCAGTGTTAGGGACAAAAG -3'
(R):5'- ATGAGGCACCGTCAGAGTTC -3'

Sequencing Primer
(F):5'- ACACGCTAGGCAGGCTCTAC -3'
(R):5'- TTCGCCTGGGCAGAAGACAG -3'
Posted On 2020-09-02