Incidental Mutation 'R8400:Dmxl2'
ID 647822
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene Name Dmx-like 2
Synonyms E130119P06Rik, 6430411K14Rik
MMRRC Submission 067763-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 54272442-54408910 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 54291037 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 2471 (Y2471C)
Ref Sequence ENSEMBL: ENSMUSP00000113705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000118163
AA Change: Y2471C

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: Y2471C

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000118600
AA Change: Y2470C
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: Y2470C

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268
AA Change: Y1672C

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
WD40 187 231 1.15e1 SMART
WD40 438 475 2.84e2 SMART
Pfam:Rav1p_C 632 1105 9.1e-72 PFAM
low complexity region 1180 1195 N/A INTRINSIC
coiled coil region 1319 1347 N/A INTRINSIC
low complexity region 1391 1406 N/A INTRINSIC
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1674 1692 N/A INTRINSIC
low complexity region 1925 1947 N/A INTRINSIC
WD40 1955 1990 5.73e0 SMART
WD40 1994 2033 8.88e0 SMART
WD40 2040 2082 2.67e-1 SMART
WD40 2088 2127 2.57e-2 SMART
WD40 2130 2169 3.61e-6 SMART
WD40 2182 2220 8.25e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,243,925 (GRCm39) M1929I probably benign Het
Abca13 T C 11: 9,248,218 (GRCm39) I2655T probably damaging Het
Acad10 A G 5: 121,764,268 (GRCm39) V887A possibly damaging Het
Acot10 T C 15: 20,666,258 (GRCm39) E161G possibly damaging Het
Astn1 C T 1: 158,484,670 (GRCm39) P919L probably benign Het
Atp1a4 T A 1: 172,062,061 (GRCm39) D688V probably damaging Het
C4bp C A 1: 130,564,484 (GRCm39) C400F probably damaging Het
Col6a6 A C 9: 105,651,995 (GRCm39) D1005E probably damaging Het
Csnk1g3 C T 18: 54,086,360 (GRCm39) R422C probably benign Het
Cutc T C 19: 43,741,644 (GRCm39) S15P probably benign Het
Dgkb T C 12: 38,652,837 (GRCm39) probably null Het
Disc1 T C 8: 125,959,732 (GRCm39) V748A probably benign Het
Dmbt1 C G 7: 130,684,317 (GRCm39) D778E unknown Het
Fam185a T A 5: 21,643,814 (GRCm39) N243K probably benign Het
Fchsd2 A T 7: 100,902,780 (GRCm39) Q386L possibly damaging Het
Gm904 C A 13: 50,797,453 (GRCm39) P49Q probably damaging Het
H2-Q10 C T 17: 35,781,374 (GRCm39) R59C probably damaging Het
Ier5l A G 2: 30,363,105 (GRCm39) Y307H possibly damaging Het
Kmt2e C A 5: 23,702,090 (GRCm39) T906K probably benign Het
Kndc1 C T 7: 139,493,434 (GRCm39) R467W probably damaging Het
Muc5ac C A 7: 141,364,213 (GRCm39) T2508K probably damaging Het
Nlrp9a A T 7: 26,264,431 (GRCm39) M784L probably benign Het
Nlrp9b T A 7: 19,757,937 (GRCm39) C391* probably null Het
Nubp2 A C 17: 25,103,439 (GRCm39) M146R probably damaging Het
Or10q3 T A 19: 11,848,578 (GRCm39) M1L probably damaging Het
Or1a1b C T 11: 74,097,221 (GRCm39) V274M possibly damaging Het
Or2ag1b T A 7: 106,288,876 (GRCm39) S21C probably benign Het
Or2b2 G A 13: 21,888,085 (GRCm39) V305M probably benign Het
Or4k45 A T 2: 111,395,747 (GRCm39) L14H probably damaging Het
Or7e166 A T 9: 19,624,389 (GRCm39) N89Y probably benign Het
Otud1 T C 2: 19,663,189 (GRCm39) V106A possibly damaging Het
Pcdhac1 T A 18: 37,225,453 (GRCm39) Y755* probably null Het
Pkd1l3 C T 8: 110,350,520 (GRCm39) P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,119,477 (GRCm39) probably benign Het
Samhd1 T C 2: 156,941,353 (GRCm39) E648G probably benign Het
Smarca5 T C 8: 81,435,756 (GRCm39) T794A probably benign Het
Spc24 A T 9: 21,669,026 (GRCm39) L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Stra6l G A 4: 45,864,905 (GRCm39) R77Q probably damaging Het
Tdrd1 G A 19: 56,837,081 (GRCm39) V472M probably benign Het
Tsc2 A T 17: 24,823,961 (GRCm39) I948K possibly damaging Het
Ttc39d T C 17: 80,523,434 (GRCm39) V31A probably benign Het
Vmn1r158 A T 7: 22,489,305 (GRCm39) C301* probably null Het
Vmn2r22 A T 6: 123,614,486 (GRCm39) L368* probably null Het
Vmn2r79 A G 7: 86,651,308 (GRCm39) T236A probably benign Het
Vwa1 T C 4: 155,857,225 (GRCm39) H191R probably benign Het
Zdbf2 T A 1: 63,344,135 (GRCm39) V838E possibly damaging Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54,308,988 (GRCm39) missense probably benign
IGL00226:Dmxl2 APN 9 54,323,277 (GRCm39) missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54,313,951 (GRCm39) missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54,358,122 (GRCm39) missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54,322,706 (GRCm39) unclassified probably benign
IGL00852:Dmxl2 APN 9 54,330,597 (GRCm39) nonsense probably null
IGL00857:Dmxl2 APN 9 54,283,604 (GRCm39) missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54,324,166 (GRCm39) missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54,366,248 (GRCm39) missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54,322,759 (GRCm39) missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54,352,660 (GRCm39) splice site probably benign
IGL01645:Dmxl2 APN 9 54,286,017 (GRCm39) missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54,308,349 (GRCm39) missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54,311,299 (GRCm39) nonsense probably null
IGL02145:Dmxl2 APN 9 54,281,981 (GRCm39) missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54,311,333 (GRCm39) missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54,352,717 (GRCm39) missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54,301,052 (GRCm39) missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54,301,127 (GRCm39) missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54,301,032 (GRCm39) missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54,313,899 (GRCm39) missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54,273,698 (GRCm39) utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54,324,229 (GRCm39) missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54,311,456 (GRCm39) missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54,323,655 (GRCm39) missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54,311,504 (GRCm39) missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54,353,956 (GRCm39) missense probably damaging 1.00
BB003:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
BB013:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
I2288:Dmxl2 UTSW 9 54,309,077 (GRCm39) missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54,309,048 (GRCm39) missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54,286,223 (GRCm39) missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54,307,224 (GRCm39) critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54,324,235 (GRCm39) missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54,291,034 (GRCm39) missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54,301,120 (GRCm39) missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54,313,190 (GRCm39) missense possibly damaging 0.95
R0605:Dmxl2 UTSW 9 54,327,229 (GRCm39) missense probably benign 0.01
R0625:Dmxl2 UTSW 9 54,289,986 (GRCm39) missense probably benign
R0626:Dmxl2 UTSW 9 54,323,838 (GRCm39) missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54,286,101 (GRCm39) missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54,313,112 (GRCm39) missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54,273,724 (GRCm39) missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54,353,696 (GRCm39) missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54,275,049 (GRCm39) missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54,323,717 (GRCm39) missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54,303,533 (GRCm39) missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54,322,712 (GRCm39) critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54,354,272 (GRCm39) nonsense probably null
R1609:Dmxl2 UTSW 9 54,316,547 (GRCm39) missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54,289,311 (GRCm39) missense probably benign
R1660:Dmxl2 UTSW 9 54,358,314 (GRCm39) missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54,308,769 (GRCm39) missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54,330,508 (GRCm39) splice site probably benign
R1832:Dmxl2 UTSW 9 54,368,233 (GRCm39) missense probably damaging 0.97
R1922:Dmxl2 UTSW 9 54,308,807 (GRCm39) missense probably benign
R2104:Dmxl2 UTSW 9 54,322,848 (GRCm39) missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54,301,097 (GRCm39) missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54,323,194 (GRCm39) missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54,283,527 (GRCm39) missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54,301,146 (GRCm39) missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54,307,378 (GRCm39) missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54,300,986 (GRCm39) missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54,384,745 (GRCm39) missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54,300,927 (GRCm39) missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54,301,053 (GRCm39) missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54,277,162 (GRCm39) missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54,381,116 (GRCm39) splice site probably benign
R4004:Dmxl2 UTSW 9 54,353,674 (GRCm39) missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54,353,674 (GRCm39) missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54,286,297 (GRCm39) splice site probably null
R4014:Dmxl2 UTSW 9 54,285,993 (GRCm39) splice site probably null
R4115:Dmxl2 UTSW 9 54,354,272 (GRCm39) nonsense probably null
R4232:Dmxl2 UTSW 9 54,327,193 (GRCm39) missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54,303,551 (GRCm39) missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54,327,168 (GRCm39) missense probably null 0.17
R4552:Dmxl2 UTSW 9 54,359,047 (GRCm39) missense probably damaging 1.00
R4609:Dmxl2 UTSW 9 54,353,796 (GRCm39) missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54,311,404 (GRCm39) missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54,354,189 (GRCm39) missense probably benign 0.04
R4711:Dmxl2 UTSW 9 54,358,208 (GRCm39) missense probably benign 0.37
R4715:Dmxl2 UTSW 9 54,353,689 (GRCm39) splice site probably null
R4746:Dmxl2 UTSW 9 54,359,080 (GRCm39) missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54,287,099 (GRCm39) missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54,311,325 (GRCm39) missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54,318,937 (GRCm39) missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54,408,725 (GRCm39) utr 5 prime probably benign
R5026:Dmxl2 UTSW 9 54,323,960 (GRCm39) missense probably damaging 1.00
R5118:Dmxl2 UTSW 9 54,368,271 (GRCm39) missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54,352,768 (GRCm39) splice site probably null
R5288:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5373:Dmxl2 UTSW 9 54,276,473 (GRCm39) intron probably benign
R5374:Dmxl2 UTSW 9 54,276,473 (GRCm39) intron probably benign
R5385:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5386:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5418:Dmxl2 UTSW 9 54,281,935 (GRCm39) critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54,301,141 (GRCm39) missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54,330,643 (GRCm39) splice site probably null
R5733:Dmxl2 UTSW 9 54,283,550 (GRCm39) missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54,380,248 (GRCm39) missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54,282,792 (GRCm39) missense probably damaging 1.00
R5893:Dmxl2 UTSW 9 54,294,704 (GRCm39) missense possibly damaging 0.64
R6030:Dmxl2 UTSW 9 54,300,957 (GRCm39) missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54,300,957 (GRCm39) missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54,324,037 (GRCm39) missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54,301,011 (GRCm39) missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54,323,046 (GRCm39) missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54,289,990 (GRCm39) missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54,327,193 (GRCm39) missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54,282,820 (GRCm39) missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54,323,960 (GRCm39) missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54,318,908 (GRCm39) missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54,323,372 (GRCm39) missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54,323,808 (GRCm39) missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54,323,808 (GRCm39) missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54,316,467 (GRCm39) missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54,387,664 (GRCm39) missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54,379,496 (GRCm39) missense probably damaging 1.00
R6979:Dmxl2 UTSW 9 54,358,163 (GRCm39) missense possibly damaging 0.49
R7147:Dmxl2 UTSW 9 54,324,013 (GRCm39) missense probably benign 0.06
R7327:Dmxl2 UTSW 9 54,308,869 (GRCm39) missense probably damaging 1.00
R7462:Dmxl2 UTSW 9 54,273,916 (GRCm39) splice site probably null
R7526:Dmxl2 UTSW 9 54,308,241 (GRCm39) missense possibly damaging 0.47
R7569:Dmxl2 UTSW 9 54,323,271 (GRCm39) missense possibly damaging 0.51
R7622:Dmxl2 UTSW 9 54,379,502 (GRCm39) missense probably damaging 0.99
R7638:Dmxl2 UTSW 9 54,365,078 (GRCm39) missense unknown
R7703:Dmxl2 UTSW 9 54,368,370 (GRCm39) missense probably benign 0.01
R7768:Dmxl2 UTSW 9 54,288,223 (GRCm39) missense probably damaging 1.00
R7926:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
R7969:Dmxl2 UTSW 9 54,354,165 (GRCm39) missense possibly damaging 0.85
R8007:Dmxl2 UTSW 9 54,290,975 (GRCm39) nonsense probably null
R8200:Dmxl2 UTSW 9 54,387,630 (GRCm39) missense probably benign
R8311:Dmxl2 UTSW 9 54,354,217 (GRCm39) missense probably benign 0.00
R8320:Dmxl2 UTSW 9 54,291,043 (GRCm39) missense probably benign
R8377:Dmxl2 UTSW 9 54,286,032 (GRCm39) missense probably damaging 1.00
R8509:Dmxl2 UTSW 9 54,335,341 (GRCm39) nonsense probably null
R8698:Dmxl2 UTSW 9 54,281,953 (GRCm39) missense probably benign 0.10
R8768:Dmxl2 UTSW 9 54,301,105 (GRCm39) missense possibly damaging 0.83
R8770:Dmxl2 UTSW 9 54,311,298 (GRCm39) missense probably benign 0.01
R8799:Dmxl2 UTSW 9 54,327,027 (GRCm39) critical splice donor site probably null
R8840:Dmxl2 UTSW 9 54,309,139 (GRCm39) missense possibly damaging 0.58
R8898:Dmxl2 UTSW 9 54,308,941 (GRCm39) missense probably benign 0.01
R8954:Dmxl2 UTSW 9 54,381,156 (GRCm39) missense probably benign 0.04
R9083:Dmxl2 UTSW 9 54,316,548 (GRCm39) missense probably benign 0.29
R9114:Dmxl2 UTSW 9 54,307,321 (GRCm39) missense
R9115:Dmxl2 UTSW 9 54,309,011 (GRCm39) missense probably benign
R9263:Dmxl2 UTSW 9 54,358,945 (GRCm39) missense probably benign 0.01
R9272:Dmxl2 UTSW 9 54,311,404 (GRCm39) missense possibly damaging 0.55
R9577:Dmxl2 UTSW 9 54,323,664 (GRCm39) missense unknown
R9673:Dmxl2 UTSW 9 54,294,840 (GRCm39) missense probably damaging 1.00
R9722:Dmxl2 UTSW 9 54,323,892 (GRCm39) missense probably benign 0.00
R9726:Dmxl2 UTSW 9 54,322,996 (GRCm39) missense probably benign 0.09
R9797:Dmxl2 UTSW 9 54,358,187 (GRCm39) missense probably benign 0.00
X0064:Dmxl2 UTSW 9 54,308,997 (GRCm39) missense probably benign
Z1177:Dmxl2 UTSW 9 54,289,318 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTATTCTAGAAACTTACCTGAAAGG -3'
(R):5'- AGACAACTTACCCCTGGTAATTTTG -3'

Sequencing Primer
(F):5'- CTGCCTAGCTCTGCTGGAATTAAAG -3'
(R):5'- TGACTTTCATAAATCTAGAACCTGC -3'
Posted On 2020-09-02