Mutagenetix > Incidental Mutation

Incidental Mutation 'R8400:Col6a6'

647823

Institutional Source

Beutler Lab

Gene Symbol

Col6a6

Ensembl Gene

ENSMUSG00000043719

Gene Name

collagen, type VI, alpha 6

Synonyms

E330026B02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R8400 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105687809-105828160 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 105774796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1005 (D1005E)

Ref Sequence

ENSEMBL: ENSMUSP00000060840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060896] [ENSMUST00000098441] [ENSMUST00000166431]

AlphaFold

Q8C6K9

Predicted Effect

probably damaging
Transcript: ENSMUST00000060896
AA Change: D1005E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000060840
Gene: ENSMUSG00000043719
AA Change: D1005E

Domain	Start	End	E-Value	Type
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098441
AA Change: D1005E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: D1005E

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	3.3e-9	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166431
AA Change: D1005E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: D1005E

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	9.3e-10	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	A	11: 9,293,925	M1929I	probably benign	Het
Abca13	T	C	11: 9,298,218	I2655T	probably damaging	Het
Acad10	A	G	5: 121,626,205	V887A	possibly damaging	Het
Acot10	T	C	15: 20,666,172	E161G	possibly damaging	Het
Astn1	C	T	1: 158,657,100	P919L	probably benign	Het
Atp1a4	T	A	1: 172,234,494	D688V	probably damaging	Het
C4bp	C	A	1: 130,636,747	C400F	probably damaging	Het
Csnk1g3	C	T	18: 53,953,288	R422C	probably benign	Het
Cutc	T	C	19: 43,753,205	S15P	probably benign	Het
Dgkb	T	C	12: 38,602,838		probably null	Het
Disc1	T	C	8: 125,232,993	V748A	probably benign	Het
Dmbt1	C	G	7: 131,082,587	D778E	unknown	Het
Dmxl2	T	C	9: 54,383,753	Y2471C	probably benign	Het
Fam185a	T	A	5: 21,438,816	N243K	probably benign	Het
Fchsd2	A	T	7: 101,253,573	Q386L	possibly damaging	Het
Gm904	C	A	13: 50,643,417	P49Q	probably damaging	Het
H2-Q10	C	T	17: 35,470,477	R59C	probably damaging	Het
Ier5l	A	G	2: 30,473,093	Y307H	possibly damaging	Het
Kmt2e	C	A	5: 23,497,092	T906K	probably benign	Het
Kndc1	C	T	7: 139,913,518	R467W	probably damaging	Het
Muc5ac	C	A	7: 141,810,476	T2508K	probably damaging	Het
Nlrp9a	A	T	7: 26,565,006	M784L	probably benign	Het
Nlrp9b	T	A	7: 20,024,012	C391*	probably null	Het
Nubp2	A	C	17: 24,884,465	M146R	probably damaging	Het
Olfr1295	A	T	2: 111,565,402	L14H	probably damaging	Het
Olfr1359	G	A	13: 21,703,915	V305M	probably benign	Het
Olfr1419	T	A	19: 11,871,214	M1L	probably damaging	Het
Olfr43	C	T	11: 74,206,395	V274M	possibly damaging	Het
Olfr694	T	A	7: 106,689,669	S21C	probably benign	Het
Olfr857	A	T	9: 19,713,093	N89Y	probably benign	Het
Otud1	T	C	2: 19,658,378	V106A	possibly damaging	Het
Pcdhac1	T	A	18: 37,092,400	Y755*	probably null	Het
Pkd1l3	C	T	8: 109,623,888	P455L	possibly damaging	Het
Ptprb	GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	10: 116,283,572		probably benign	Het
Samhd1	T	C	2: 157,099,433	E648G	probably benign	Het
Smarca5	T	C	8: 80,709,127	T794A	probably benign	Het
Spc24	A	T	9: 21,757,730	L87H	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Stra6l	G	A	4: 45,864,905	R77Q	probably damaging	Het
Tdrd1	G	A	19: 56,848,649	V472M	probably benign	Het
Tsc2	A	T	17: 24,604,987	I948K	possibly damaging	Het
Ttc39d	T	C	17: 80,216,005	V31A	probably benign	Het
Vmn1r158	A	T	7: 22,789,880	C301*	probably null	Het
Vmn2r22	A	T	6: 123,637,527	L368*	probably null	Het
Vmn2r79	A	G	7: 87,002,100	T236A	probably benign	Het
Vwa1	T	C	4: 155,772,768	H191R	probably benign	Het
Zdbf2	T	A	1: 63,304,976	V838E	possibly damaging	Het

Other mutations in Col6a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Col6a6	APN	9	105758191	critical splice acceptor site	probably null
IGL00768:Col6a6	APN	9	105782412	missense	probably benign	0.04
IGL00917:Col6a6	APN	9	105784254	splice site	probably benign
IGL01385:Col6a6	APN	9	105783666	missense	probably damaging	1.00
IGL01411:Col6a6	APN	9	105785958	nonsense	probably null
IGL01508:Col6a6	APN	9	105727166	splice site	probably benign
IGL01668:Col6a6	APN	9	105709271	missense	probably damaging	1.00
IGL01733:Col6a6	APN	9	105709255	missense	possibly damaging	0.92
IGL01932:Col6a6	APN	9	105689626	missense	probably benign	0.02
IGL01934:Col6a6	APN	9	105698659	critical splice donor site	probably null
IGL01944:Col6a6	APN	9	105783909	missense	probably damaging	1.00
IGL01980:Col6a6	APN	9	105780985	missense	probably damaging	0.96
IGL02114:Col6a6	APN	9	105767199	critical splice donor site	probably null
IGL02129:Col6a6	APN	9	105736340	splice site	probably benign
IGL02201:Col6a6	APN	9	105780995	missense	probably damaging	1.00
IGL02335:Col6a6	APN	9	105784101	missense	probably damaging	1.00
IGL02541:Col6a6	APN	9	105732216	missense	probably benign	0.05
IGL02574:Col6a6	APN	9	105782191	missense	probably damaging	1.00
IGL02649:Col6a6	APN	9	105727170	critical splice donor site	probably null
IGL02852:Col6a6	APN	9	105784073	missense	probably damaging	0.99
IGL03278:Col6a6	APN	9	105709452	missense	probably benign	0.01
IGL03327:Col6a6	APN	9	105767234	missense	possibly damaging	0.90
PIT4519001:Col6a6	UTSW	9	105732263	missense	probably benign	0.23
R0042:Col6a6	UTSW	9	105780697	missense	possibly damaging	0.89
R0046:Col6a6	UTSW	9	105748848	splice site	probably benign
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0140:Col6a6	UTSW	9	105702275	missense	probably damaging	1.00
R0278:Col6a6	UTSW	9	105767288	missense	possibly damaging	0.87
R0281:Col6a6	UTSW	9	105784116	missense	probably benign	0.13
R0382:Col6a6	UTSW	9	105755555	missense	probably damaging	0.98
R0389:Col6a6	UTSW	9	105784204	missense	probably benign	0.02
R0421:Col6a6	UTSW	9	105784206	missense	probably benign	0.02
R0502:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0503:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0600:Col6a6	UTSW	9	105761440	missense	probably damaging	1.00
R0626:Col6a6	UTSW	9	105777744	missense	probably benign	0.45
R0629:Col6a6	UTSW	9	105727165	splice site	probably benign
R0690:Col6a6	UTSW	9	105709486	missense	probably benign	0.01
R1155:Col6a6	UTSW	9	105782090	missense	possibly damaging	0.64
R1245:Col6a6	UTSW	9	105748910	missense	possibly damaging	0.62
R1253:Col6a6	UTSW	9	105774303	missense	probably null	0.98
R1263:Col6a6	UTSW	9	105709489	missense	probably benign	0.01
R1296:Col6a6	UTSW	9	105781091	missense	probably damaging	1.00
R1556:Col6a6	UTSW	9	105709473	missense	possibly damaging	0.82
R1600:Col6a6	UTSW	9	105778075	missense	probably damaging	1.00
R1612:Col6a6	UTSW	9	105777549	missense	probably damaging	1.00
R1613:Col6a6	UTSW	9	105732211	critical splice donor site	probably null
R1830:Col6a6	UTSW	9	105702270	missense	probably damaging	0.99
R1858:Col6a6	UTSW	9	105781102	missense	probably damaging	1.00
R1897:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R1944:Col6a6	UTSW	9	105709384	missense	probably damaging	1.00
R2366:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R2484:Col6a6	UTSW	9	105780804	missense	probably damaging	0.98
R3079:Col6a6	UTSW	9	105754223	missense	probably benign	0.01
R3176:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3276:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3429:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R3716:Col6a6	UTSW	9	105782174	missense	probably damaging	0.98
R3809:Col6a6	UTSW	9	105780692	missense	probably damaging	1.00
R3978:Col6a6	UTSW	9	105698879	missense	probably damaging	0.98
R4087:Col6a6	UTSW	9	105783956	missense	possibly damaging	0.68
R4382:Col6a6	UTSW	9	105783690	missense	probably damaging	1.00
R4516:Col6a6	UTSW	9	105698949	missense	possibly damaging	0.64
R4666:Col6a6	UTSW	9	105767342	missense	possibly damaging	0.93
R4905:Col6a6	UTSW	9	105767424	missense	probably damaging	1.00
R4923:Col6a6	UTSW	9	105788948	missense	probably damaging	1.00
R4951:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R5002:Col6a6	UTSW	9	105786093	missense	probably benign	0.00
R5111:Col6a6	UTSW	9	105709474	missense	possibly damaging	0.70
R5205:Col6a6	UTSW	9	105782033	missense	probably damaging	0.99
R5399:Col6a6	UTSW	9	105709107	missense	possibly damaging	0.50
R5475:Col6a6	UTSW	9	105774338	missense	probably null	0.79
R5491:Col6a6	UTSW	9	105738236	missense	probably damaging	0.98
R5758:Col6a6	UTSW	9	105761518	critical splice acceptor site	probably null
R5934:Col6a6	UTSW	9	105767075	missense	probably damaging	1.00
R6059:Col6a6	UTSW	9	105783917	missense	probably damaging	1.00
R6284:Col6a6	UTSW	9	105727227	splice site	probably null
R6425:Col6a6	UTSW	9	105698865	missense	probably benign	0.21
R6464:Col6a6	UTSW	9	105788953	start codon destroyed	probably null	0.60
R6469:Col6a6	UTSW	9	105698691	missense	probably damaging	0.97
R6520:Col6a6	UTSW	9	105785825	missense	possibly damaging	0.89
R6552:Col6a6	UTSW	9	105698913	missense	probably damaging	1.00
R6750:Col6a6	UTSW	9	105783680	missense	probably damaging	1.00
R6813:Col6a6	UTSW	9	105783941	missense	probably benign	0.32
R7032:Col6a6	UTSW	9	105767508	missense	probably damaging	0.96
R7260:Col6a6	UTSW	9	105783969	missense	probably benign	0.00
R7472:Col6a6	UTSW	9	105782423	missense	probably damaging	1.00
R7541:Col6a6	UTSW	9	105767324	missense	probably damaging	1.00
R7640:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R7645:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R7716:Col6a6	UTSW	9	105783903	missense	possibly damaging	0.84
R7866:Col6a6	UTSW	9	105689561	missense	probably damaging	0.96
R7938:Col6a6	UTSW	9	105780684	nonsense	probably null
R8016:Col6a6	UTSW	9	105767528	missense	possibly damaging	0.73
R8043:Col6a6	UTSW	9	105699020	missense	probably damaging	0.98
R8073:Col6a6	UTSW	9	105781947	missense	probably benign	0.01
R8082:Col6a6	UTSW	9	105783930	nonsense	probably null
R8243:Col6a6	UTSW	9	105699269	missense	probably damaging	1.00
R8306:Col6a6	UTSW	9	105784073	missense	probably damaging	0.96
R8324:Col6a6	UTSW	9	105755654	missense	probably benign	0.25
R8384:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R8523:Col6a6	UTSW	9	105774788	missense	possibly damaging	0.71
R8842:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R8862:Col6a6	UTSW	9	105786149	missense	probably damaging	1.00
R8907:Col6a6	UTSW	9	105767329	missense	probably damaging	0.99
R9021:Col6a6	UTSW	9	105709546	missense	possibly damaging	0.85
R9088:Col6a6	UTSW	9	105784077	missense	probably damaging	0.99
R9178:Col6a6	UTSW	9	105781970	missense	probably benign	0.30
R9225:Col6a6	UTSW	9	105782238	missense	possibly damaging	0.75
R9340:Col6a6	UTSW	9	105774558	missense	probably damaging	1.00
R9342:Col6a6	UTSW	9	105785973	missense	probably benign	0.00
R9360:Col6a6	UTSW	9	105767487	missense	probably benign	0.00
R9368:Col6a6	UTSW	9	105786101	missense	possibly damaging	0.48
R9398:Col6a6	UTSW	9	105774626	missense	probably benign	0.40
R9450:Col6a6	UTSW	9	105784174	missense	probably benign
R9454:Col6a6	UTSW	9	105783860	missense	probably damaging	0.99
R9458:Col6a6	UTSW	9	105709162	missense	probably benign	0.01
R9563:Col6a6	UTSW	9	105695753	missense	probably benign	0.02
R9568:Col6a6	UTSW	9	105780727	missense	possibly damaging	0.58
R9613:Col6a6	UTSW	9	105739202	missense	probably benign	0.07
R9664:Col6a6	UTSW	9	105781055	missense	probably benign	0.11
R9747:Col6a6	UTSW	9	105784040	missense	probably benign	0.29
R9760:Col6a6	UTSW	9	105782054	missense	probably damaging	0.99
X0022:Col6a6	UTSW	9	105699332	missense	probably damaging	1.00
Z1176:Col6a6	UTSW	9	105780952	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105728255	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105788895	missense	probably null	0.24

Predicted Primers

PCR Primer
(F):5'- TGGGTGGATATCTCCCTCTC -3'
(R):5'- ATAAGTCCCGCTGCCTTTATG -3'

Sequencing Primer
(F):5'- TCTCCCCGGTGAACGTC -3'
(R):5'- ATTCTCCAATTAATATGACCACAGAG -3'

Posted On

2020-09-02