Incidental Mutation 'R8400:Sppl2b'
ID647824
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R8400 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80866069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
C4bp C A 1: 130,636,747 C400F probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Csnk1g3 C T 18: 53,953,288 R422C probably benign Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
H2-Q10 C T 17: 35,470,477 R59C probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr1419 T A 19: 11,871,214 M1L probably damaging Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Samhd1 T C 2: 157,099,433 E648G probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Spc24 A T 9: 21,757,730 L87H probably damaging Het
Stra6l G A 4: 45,864,905 R77Q probably damaging Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Ttc39d T C 17: 80,216,005 V31A probably benign Het
Vmn1r158 A T 7: 22,789,880 C301* probably null Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vmn2r79 A G 7: 87,002,100 T236A probably benign Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R4350:Sppl2b UTSW 10 80862726 missense probably benign 0.12
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8212:Sppl2b UTSW 10 80865359 missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80866069 frame shift probably null
R8265:Sppl2b UTSW 10 80866069 frame shift probably null
R8367:Sppl2b UTSW 10 80863191 missense probably benign 0.02
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8398:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8481:Sppl2b UTSW 10 80866069 frame shift probably null
R8505:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8818:Sppl2b UTSW 10 80866069 frame shift probably null
R8832:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGATGTGCATGCCCATTGTC -3'
(R):5'- TGGGCCAGACACTCAACTACTC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- AAGCCCAGCCCCACTAGG -3'
Posted On2020-09-02