Incidental Mutation 'R8400:Ptprb'
ID 647825
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Name protein tyrosine phosphatase receptor type B
Synonyms 3230402H02Rik, VE-PTP
MMRRC Submission 067763-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8400 (G1)
Quality Score 214.458
Status Not validated
Chromosome 10
Chromosomal Location 116111428-116225440 bp(+) (GRCm39)
Type of Mutation small deletion (14 aa in frame mutation)
DNA Base Change (assembly) GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT at 116119477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000218553]
AlphaFold B2RU80
Predicted Effect probably benign
Transcript: ENSMUST00000218553
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,243,925 (GRCm39) M1929I probably benign Het
Abca13 T C 11: 9,248,218 (GRCm39) I2655T probably damaging Het
Acad10 A G 5: 121,764,268 (GRCm39) V887A possibly damaging Het
Acot10 T C 15: 20,666,258 (GRCm39) E161G possibly damaging Het
Astn1 C T 1: 158,484,670 (GRCm39) P919L probably benign Het
Atp1a4 T A 1: 172,062,061 (GRCm39) D688V probably damaging Het
C4bp C A 1: 130,564,484 (GRCm39) C400F probably damaging Het
Col6a6 A C 9: 105,651,995 (GRCm39) D1005E probably damaging Het
Csnk1g3 C T 18: 54,086,360 (GRCm39) R422C probably benign Het
Cutc T C 19: 43,741,644 (GRCm39) S15P probably benign Het
Dgkb T C 12: 38,652,837 (GRCm39) probably null Het
Disc1 T C 8: 125,959,732 (GRCm39) V748A probably benign Het
Dmbt1 C G 7: 130,684,317 (GRCm39) D778E unknown Het
Dmxl2 T C 9: 54,291,037 (GRCm39) Y2471C probably benign Het
Fam185a T A 5: 21,643,814 (GRCm39) N243K probably benign Het
Fchsd2 A T 7: 100,902,780 (GRCm39) Q386L possibly damaging Het
Gm904 C A 13: 50,797,453 (GRCm39) P49Q probably damaging Het
H2-Q10 C T 17: 35,781,374 (GRCm39) R59C probably damaging Het
Ier5l A G 2: 30,363,105 (GRCm39) Y307H possibly damaging Het
Kmt2e C A 5: 23,702,090 (GRCm39) T906K probably benign Het
Kndc1 C T 7: 139,493,434 (GRCm39) R467W probably damaging Het
Muc5ac C A 7: 141,364,213 (GRCm39) T2508K probably damaging Het
Nlrp9a A T 7: 26,264,431 (GRCm39) M784L probably benign Het
Nlrp9b T A 7: 19,757,937 (GRCm39) C391* probably null Het
Nubp2 A C 17: 25,103,439 (GRCm39) M146R probably damaging Het
Or10q3 T A 19: 11,848,578 (GRCm39) M1L probably damaging Het
Or1a1b C T 11: 74,097,221 (GRCm39) V274M possibly damaging Het
Or2ag1b T A 7: 106,288,876 (GRCm39) S21C probably benign Het
Or2b2 G A 13: 21,888,085 (GRCm39) V305M probably benign Het
Or4k45 A T 2: 111,395,747 (GRCm39) L14H probably damaging Het
Or7e166 A T 9: 19,624,389 (GRCm39) N89Y probably benign Het
Otud1 T C 2: 19,663,189 (GRCm39) V106A possibly damaging Het
Pcdhac1 T A 18: 37,225,453 (GRCm39) Y755* probably null Het
Pkd1l3 C T 8: 110,350,520 (GRCm39) P455L possibly damaging Het
Samhd1 T C 2: 156,941,353 (GRCm39) E648G probably benign Het
Smarca5 T C 8: 81,435,756 (GRCm39) T794A probably benign Het
Spc24 A T 9: 21,669,026 (GRCm39) L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Stra6l G A 4: 45,864,905 (GRCm39) R77Q probably damaging Het
Tdrd1 G A 19: 56,837,081 (GRCm39) V472M probably benign Het
Tsc2 A T 17: 24,823,961 (GRCm39) I948K possibly damaging Het
Ttc39d T C 17: 80,523,434 (GRCm39) V31A probably benign Het
Vmn1r158 A T 7: 22,489,305 (GRCm39) C301* probably null Het
Vmn2r22 A T 6: 123,614,486 (GRCm39) L368* probably null Het
Vmn2r79 A G 7: 86,651,308 (GRCm39) T236A probably benign Het
Vwa1 T C 4: 155,857,225 (GRCm39) H191R probably benign Het
Zdbf2 T A 1: 63,344,135 (GRCm39) V838E possibly damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116,198,553 (GRCm39) missense probably benign 0.15
IGL01354:Ptprb APN 10 116,179,796 (GRCm39) missense probably benign 0.24
IGL01404:Ptprb APN 10 116,175,341 (GRCm39) missense probably benign 0.14
IGL01410:Ptprb APN 10 116,138,179 (GRCm39) missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116,179,820 (GRCm39) missense probably benign 0.27
IGL01731:Ptprb APN 10 116,208,781 (GRCm39) missense probably damaging 1.00
IGL02003:Ptprb APN 10 116,203,410 (GRCm39) missense probably damaging 1.00
IGL02110:Ptprb APN 10 116,167,108 (GRCm39) splice site probably benign
IGL02178:Ptprb APN 10 116,158,437 (GRCm39) missense probably benign 0.00
IGL02304:Ptprb APN 10 116,167,164 (GRCm39) missense probably damaging 1.00
IGL02324:Ptprb APN 10 116,155,238 (GRCm39) missense probably benign 0.03
IGL02388:Ptprb APN 10 116,203,426 (GRCm39) missense probably damaging 1.00
IGL02640:Ptprb APN 10 116,174,569 (GRCm39) missense probably damaging 0.99
IGL02698:Ptprb APN 10 116,199,185 (GRCm39) missense probably benign 0.05
IGL02876:Ptprb APN 10 116,184,116 (GRCm39) splice site probably benign
IGL02879:Ptprb APN 10 116,163,873 (GRCm39) missense probably benign
IGL02982:Ptprb APN 10 116,158,533 (GRCm39) missense probably benign 0.20
IGL03146:Ptprb APN 10 116,164,032 (GRCm39) missense probably benign 0.14
IGL03351:Ptprb APN 10 116,175,487 (GRCm39) missense probably benign 0.03
R0306:Ptprb UTSW 10 116,179,893 (GRCm39) missense probably benign 0.04
R0385:Ptprb UTSW 10 116,186,083 (GRCm39) missense probably benign 0.00
R0600:Ptprb UTSW 10 116,204,712 (GRCm39) missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116,138,283 (GRCm39) missense possibly damaging 0.87
R0613:Ptprb UTSW 10 116,138,230 (GRCm39) missense possibly damaging 0.59
R0850:Ptprb UTSW 10 116,175,415 (GRCm39) missense probably damaging 1.00
R0850:Ptprb UTSW 10 116,138,030 (GRCm39) missense possibly damaging 0.87
R1331:Ptprb UTSW 10 116,203,437 (GRCm39) missense probably damaging 1.00
R1413:Ptprb UTSW 10 116,175,584 (GRCm39) missense probably damaging 1.00
R1418:Ptprb UTSW 10 116,155,375 (GRCm39) missense probably benign 0.00
R1545:Ptprb UTSW 10 116,216,774 (GRCm39) missense probably damaging 1.00
R1562:Ptprb UTSW 10 116,175,372 (GRCm39) missense probably benign 0.00
R1752:Ptprb UTSW 10 116,176,895 (GRCm39) missense probably benign 0.44
R1837:Ptprb UTSW 10 116,177,531 (GRCm39) missense probably benign 0.00
R1940:Ptprb UTSW 10 116,155,515 (GRCm39) splice site probably benign
R1958:Ptprb UTSW 10 116,177,441 (GRCm39) missense probably benign 0.10
R2029:Ptprb UTSW 10 116,182,958 (GRCm39) missense probably benign 0.37
R2031:Ptprb UTSW 10 116,153,448 (GRCm39) missense probably benign
R2101:Ptprb UTSW 10 116,150,943 (GRCm39) splice site probably benign
R2209:Ptprb UTSW 10 116,205,262 (GRCm39) missense probably damaging 1.00
R3016:Ptprb UTSW 10 116,193,200 (GRCm39) missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116,179,931 (GRCm39) missense probably damaging 0.99
R3821:Ptprb UTSW 10 116,185,979 (GRCm39) missense probably benign 0.11
R3824:Ptprb UTSW 10 116,186,694 (GRCm39) missense probably benign 0.05
R3825:Ptprb UTSW 10 116,186,694 (GRCm39) missense probably benign 0.05
R3841:Ptprb UTSW 10 116,182,887 (GRCm39) missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116,177,399 (GRCm39) missense probably benign 0.00
R4125:Ptprb UTSW 10 116,189,754 (GRCm39) missense probably benign 0.12
R4227:Ptprb UTSW 10 116,138,130 (GRCm39) missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116,182,772 (GRCm39) missense probably benign
R4731:Ptprb UTSW 10 116,155,238 (GRCm39) missense probably benign 0.03
R5009:Ptprb UTSW 10 116,184,032 (GRCm39) missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116,158,364 (GRCm39) missense probably benign 0.17
R5114:Ptprb UTSW 10 116,184,088 (GRCm39) missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116,179,820 (GRCm39) missense probably benign 0.27
R5214:Ptprb UTSW 10 116,205,229 (GRCm39) missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116,189,776 (GRCm39) missense probably damaging 1.00
R5553:Ptprb UTSW 10 116,186,090 (GRCm39) missense probably damaging 1.00
R5585:Ptprb UTSW 10 116,216,759 (GRCm39) missense probably damaging 0.98
R5586:Ptprb UTSW 10 116,189,732 (GRCm39) missense probably damaging 1.00
R5808:Ptprb UTSW 10 116,175,392 (GRCm39) missense probably benign 0.00
R5875:Ptprb UTSW 10 116,184,071 (GRCm39) missense probably benign 0.00
R6051:Ptprb UTSW 10 116,176,995 (GRCm39) nonsense probably null
R6383:Ptprb UTSW 10 116,182,912 (GRCm39) nonsense probably null
R6511:Ptprb UTSW 10 116,182,725 (GRCm39) missense probably damaging 1.00
R6817:Ptprb UTSW 10 116,119,582 (GRCm39) small deletion probably benign
R6826:Ptprb UTSW 10 116,153,277 (GRCm39) missense probably benign 0.26
R6958:Ptprb UTSW 10 116,113,153 (GRCm39) missense probably benign 0.32
R7103:Ptprb UTSW 10 116,174,718 (GRCm39) missense probably damaging 1.00
R7129:Ptprb UTSW 10 116,119,582 (GRCm39) small deletion probably benign
R7181:Ptprb UTSW 10 116,204,671 (GRCm39) missense probably damaging 1.00
R7215:Ptprb UTSW 10 116,174,681 (GRCm39) missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116,164,070 (GRCm39) missense probably damaging 0.99
R7315:Ptprb UTSW 10 116,198,284 (GRCm39) missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116,177,309 (GRCm39) missense probably benign 0.01
R7381:Ptprb UTSW 10 116,177,038 (GRCm39) missense probably benign
R7412:Ptprb UTSW 10 116,177,043 (GRCm39) missense probably benign
R7483:Ptprb UTSW 10 116,119,334 (GRCm39) missense probably benign 0.01
R7495:Ptprb UTSW 10 116,177,353 (GRCm39) missense probably benign 0.12
R7508:Ptprb UTSW 10 116,189,896 (GRCm39) nonsense probably null
R7571:Ptprb UTSW 10 116,175,335 (GRCm39) missense probably damaging 1.00
R7586:Ptprb UTSW 10 116,179,779 (GRCm39) missense probably damaging 0.97
R7623:Ptprb UTSW 10 116,205,214 (GRCm39) missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116,208,853 (GRCm39) missense probably damaging 1.00
R7744:Ptprb UTSW 10 116,113,389 (GRCm39) missense probably benign 0.10
R7752:Ptprb UTSW 10 116,205,333 (GRCm39) missense probably benign 0.37
R7826:Ptprb UTSW 10 116,119,582 (GRCm39) small deletion probably benign
R7833:Ptprb UTSW 10 116,151,156 (GRCm39) missense probably benign 0.01
R7834:Ptprb UTSW 10 116,175,329 (GRCm39) missense probably benign 0.00
R7846:Ptprb UTSW 10 116,119,453 (GRCm39) missense probably benign 0.17
R7896:Ptprb UTSW 10 116,205,362 (GRCm39) splice site probably null
R7901:Ptprb UTSW 10 116,205,333 (GRCm39) missense probably benign 0.37
R7912:Ptprb UTSW 10 116,158,392 (GRCm39) missense probably damaging 1.00
R7941:Ptprb UTSW 10 116,119,582 (GRCm39) small deletion probably benign
R8147:Ptprb UTSW 10 116,153,283 (GRCm39) missense probably damaging 1.00
R8202:Ptprb UTSW 10 116,189,750 (GRCm39) missense probably damaging 1.00
R8339:Ptprb UTSW 10 116,119,356 (GRCm39) missense probably benign 0.14
R8504:Ptprb UTSW 10 116,176,936 (GRCm39) missense probably benign 0.27
R8679:Ptprb UTSW 10 116,203,495 (GRCm39) missense probably damaging 1.00
R8786:Ptprb UTSW 10 116,155,306 (GRCm39) missense probably benign 0.40
R8914:Ptprb UTSW 10 116,158,567 (GRCm39) nonsense probably null
R8980:Ptprb UTSW 10 116,119,526 (GRCm39) missense probably benign 0.07
R8982:Ptprb UTSW 10 116,119,582 (GRCm39) small deletion probably benign
R9256:Ptprb UTSW 10 116,219,776 (GRCm39) missense probably damaging 1.00
R9288:Ptprb UTSW 10 116,155,353 (GRCm39) missense probably benign 0.03
R9369:Ptprb UTSW 10 116,151,057 (GRCm39) missense probably benign 0.00
R9448:Ptprb UTSW 10 116,149,819 (GRCm39) nonsense probably null
R9467:Ptprb UTSW 10 116,158,390 (GRCm39) missense probably benign 0.00
R9468:Ptprb UTSW 10 116,113,274 (GRCm39) missense probably benign 0.00
R9481:Ptprb UTSW 10 116,155,353 (GRCm39) missense probably benign 0.03
R9486:Ptprb UTSW 10 116,155,494 (GRCm39) nonsense probably null
R9513:Ptprb UTSW 10 116,138,142 (GRCm39) missense probably benign 0.00
R9529:Ptprb UTSW 10 116,174,519 (GRCm39) critical splice acceptor site probably null
R9535:Ptprb UTSW 10 116,158,431 (GRCm39) missense possibly damaging 0.92
R9614:Ptprb UTSW 10 116,203,441 (GRCm39) missense probably damaging 1.00
R9686:Ptprb UTSW 10 116,204,694 (GRCm39) missense probably damaging 1.00
RF041:Ptprb UTSW 10 116,119,582 (GRCm39) small deletion probably benign
X0020:Ptprb UTSW 10 116,138,085 (GRCm39) missense possibly damaging 0.62
Z1176:Ptprb UTSW 10 116,138,061 (GRCm39) frame shift probably null
Z1177:Ptprb UTSW 10 116,198,547 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCCAAGCGCCTTATGATAG -3'
(R):5'- TGTAGGCCTCTGAAGTGCTC -3'

Sequencing Primer
(F):5'- AACGTGAGAATGATTTTTCCCCGC -3'
(R):5'- TCCCGAGGGTCTTTGCAG -3'
Posted On 2020-09-02