Incidental Mutation 'R8400:Ttc39d'
ID 647836
Institutional Source Beutler Lab
Gene Symbol Ttc39d
Ensembl Gene ENSMUSG00000046196
Gene Name tetratricopeptide repeat domain 39D
Synonyms 4930560E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80207460-80217936 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80216005 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 31 (V31A)
Ref Sequence ENSEMBL: ENSMUSP00000123158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053168] [ENSMUST00000134652]
AlphaFold Q0VF76
Predicted Effect probably benign
Transcript: ENSMUST00000053168
AA Change: V31A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000053781
Gene: ENSMUSG00000046196
AA Change: V31A

DomainStartEndE-ValueType
Pfam:DUF3808 69 522 9.6e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134652
AA Change: V31A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123158
Gene: ENSMUSG00000046196
AA Change: V31A

DomainStartEndE-ValueType
Pfam:DUF3808 69 522 7.2e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
C4bp C A 1: 130,636,747 C400F probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Csnk1g3 C T 18: 53,953,288 R422C probably benign Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
H2-Q10 C T 17: 35,470,477 R59C probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr1419 T A 19: 11,871,214 M1L probably damaging Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Samhd1 T C 2: 157,099,433 E648G probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Spc24 A T 9: 21,757,730 L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stra6l G A 4: 45,864,905 R77Q probably damaging Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Vmn1r158 A T 7: 22,789,880 C301* probably null Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vmn2r79 A G 7: 87,002,100 T236A probably benign Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in Ttc39d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Ttc39d APN 17 80216526 missense probably damaging 0.99
IGL01065:Ttc39d APN 17 80216274 missense probably damaging 0.96
IGL01834:Ttc39d APN 17 80216046 missense probably benign
IGL02541:Ttc39d APN 17 80216446 missense probably damaging 0.99
PIT4687001:Ttc39d UTSW 17 80216925 missense probably damaging 1.00
R0042:Ttc39d UTSW 17 80215950 missense probably benign 0.02
R0042:Ttc39d UTSW 17 80215950 missense probably benign 0.02
R0124:Ttc39d UTSW 17 80216946 missense probably damaging 1.00
R0523:Ttc39d UTSW 17 80216457 missense possibly damaging 0.78
R0801:Ttc39d UTSW 17 80216215 missense probably damaging 1.00
R1581:Ttc39d UTSW 17 80216484 missense probably benign 0.02
R2071:Ttc39d UTSW 17 80216601 missense probably damaging 1.00
R2271:Ttc39d UTSW 17 80217246 missense probably damaging 1.00
R2272:Ttc39d UTSW 17 80217246 missense probably damaging 1.00
R2520:Ttc39d UTSW 17 80216370 missense probably benign 0.17
R2885:Ttc39d UTSW 17 80216715 missense probably benign 0.00
R2939:Ttc39d UTSW 17 80217553 missense probably damaging 1.00
R2940:Ttc39d UTSW 17 80217553 missense probably damaging 1.00
R3081:Ttc39d UTSW 17 80217553 missense probably damaging 1.00
R4669:Ttc39d UTSW 17 80217639 missense probably benign 0.00
R4872:Ttc39d UTSW 17 80217098 missense probably benign 0.00
R4951:Ttc39d UTSW 17 80216033 missense probably benign 0.01
R6260:Ttc39d UTSW 17 80216647 nonsense probably null
R7018:Ttc39d UTSW 17 80216181 missense probably benign 0.06
R7042:Ttc39d UTSW 17 80216462 missense probably benign 0.00
R7468:Ttc39d UTSW 17 80216150 missense possibly damaging 0.96
R7761:Ttc39d UTSW 17 80217312 missense probably damaging 0.98
R7825:Ttc39d UTSW 17 80216146 missense probably damaging 0.99
R7955:Ttc39d UTSW 17 80215923 missense probably benign
R8192:Ttc39d UTSW 17 80216578 missense probably damaging 0.99
R8682:Ttc39d UTSW 17 80217264 missense probably benign 0.01
R9019:Ttc39d UTSW 17 80215920 missense probably benign 0.03
R9453:Ttc39d UTSW 17 80217325 missense probably damaging 1.00
R9480:Ttc39d UTSW 17 80216710 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGACTGAGCTTTGTGTGGAAG -3'
(R):5'- TATCAGGGCGTGGTATGAAC -3'

Sequencing Primer
(F):5'- CTTTGTGTGGAAGAAGAGACCCTG -3'
(R):5'- TGACCATGGGTGAATAAGGTTG -3'
Posted On 2020-09-02