Incidental Mutation 'R8400:Csnk1g3'
ID 647838
Institutional Source Beutler Lab
Gene Symbol Csnk1g3
Ensembl Gene ENSMUSG00000073563
Gene Name casein kinase 1, gamma 3
Synonyms C330049O21Rik, 3300002K07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 53862113-53955684 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 53953288 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 422 (R422C)
Ref Sequence ENSEMBL: ENSMUSP00000070259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069597]
AlphaFold Q8C4X2
Predicted Effect probably benign
Transcript: ENSMUST00000069597
AA Change: R422C

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000070259
Gene: ENSMUSG00000073563
AA Change: R422C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 19 35 N/A INTRINSIC
Pfam:Pkinase 43 304 1.2e-27 PFAM
Pfam:Pkinase_Tyr 43 306 8.9e-16 PFAM
Pfam:CK1gamma_C 329 362 8.7e-9 PFAM
Pfam:CK1gamma_C 358 386 1.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of serine/threonine protein kinases that phosphorylate caseins and other acidic proteins. A related protein in the African clawed frog participates in the transmission of Wnt/beta-catenin signaling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
C4bp C A 1: 130,636,747 C400F probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
H2-Q10 C T 17: 35,470,477 R59C probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr1419 T A 19: 11,871,214 M1L probably damaging Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Samhd1 T C 2: 157,099,433 E648G probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Spc24 A T 9: 21,757,730 L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stra6l G A 4: 45,864,905 R77Q probably damaging Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Ttc39d T C 17: 80,216,005 V31A probably benign Het
Vmn1r158 A T 7: 22,789,880 C301* probably null Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vmn2r79 A G 7: 87,002,100 T236A probably benign Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in Csnk1g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Csnk1g3 APN 18 53919003 missense probably damaging 1.00
IGL02148:Csnk1g3 APN 18 53953288 missense probably benign 0.11
IGL02379:Csnk1g3 APN 18 53933492 missense probably benign 0.00
IGL02447:Csnk1g3 APN 18 53895870 missense probably benign 0.26
IGL03172:Csnk1g3 APN 18 53953284 missense possibly damaging 0.48
R0153:Csnk1g3 UTSW 18 53918789 splice site probably benign
R0606:Csnk1g3 UTSW 18 53917028 missense probably damaging 1.00
R1399:Csnk1g3 UTSW 18 53895910 missense probably damaging 0.97
R1435:Csnk1g3 UTSW 18 53906674 splice site probably null
R4829:Csnk1g3 UTSW 18 53895823 missense possibly damaging 0.85
R5552:Csnk1g3 UTSW 18 53932283 missense probably benign 0.04
R6305:Csnk1g3 UTSW 18 53932312 nonsense probably null
R6556:Csnk1g3 UTSW 18 53930282 missense possibly damaging 0.82
R7324:Csnk1g3 UTSW 18 53919018 missense probably damaging 1.00
R7401:Csnk1g3 UTSW 18 53930318 missense probably damaging 1.00
R7545:Csnk1g3 UTSW 18 53895825 missense probably damaging 0.97
R7846:Csnk1g3 UTSW 18 53948105 missense probably benign 0.03
R7968:Csnk1g3 UTSW 18 53895654 start gained probably benign
R8215:Csnk1g3 UTSW 18 53948079 missense probably benign 0.04
R8390:Csnk1g3 UTSW 18 53948078 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CATGCTTGGCTGACATGTTTTC -3'
(R):5'- ATTCAATGATGGGCAAAGCAC -3'

Sequencing Primer
(F):5'- CTCTCATCTGTCTTGCACGAG -3'
(R):5'- TGGGCAAAGCACTCGTG -3'
Posted On 2020-09-02