Incidental Mutation 'R8400:Csnk1g3'
ID 647838
Institutional Source Beutler Lab
Gene Symbol Csnk1g3
Ensembl Gene ENSMUSG00000073563
Gene Name casein kinase 1, gamma 3
Synonyms C330049O21Rik, 3300002K07Rik
MMRRC Submission 067763-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 53995194-54088620 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 54086360 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 422 (R422C)
Ref Sequence ENSEMBL: ENSMUSP00000070259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069597]
AlphaFold Q8C4X2
Predicted Effect probably benign
Transcript: ENSMUST00000069597
AA Change: R422C

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000070259
Gene: ENSMUSG00000073563
AA Change: R422C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 19 35 N/A INTRINSIC
Pfam:Pkinase 43 304 1.2e-27 PFAM
Pfam:Pkinase_Tyr 43 306 8.9e-16 PFAM
Pfam:CK1gamma_C 329 362 8.7e-9 PFAM
Pfam:CK1gamma_C 358 386 1.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of serine/threonine protein kinases that phosphorylate caseins and other acidic proteins. A related protein in the African clawed frog participates in the transmission of Wnt/beta-catenin signaling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,243,925 (GRCm39) M1929I probably benign Het
Abca13 T C 11: 9,248,218 (GRCm39) I2655T probably damaging Het
Acad10 A G 5: 121,764,268 (GRCm39) V887A possibly damaging Het
Acot10 T C 15: 20,666,258 (GRCm39) E161G possibly damaging Het
Astn1 C T 1: 158,484,670 (GRCm39) P919L probably benign Het
Atp1a4 T A 1: 172,062,061 (GRCm39) D688V probably damaging Het
C4bp C A 1: 130,564,484 (GRCm39) C400F probably damaging Het
Col6a6 A C 9: 105,651,995 (GRCm39) D1005E probably damaging Het
Cutc T C 19: 43,741,644 (GRCm39) S15P probably benign Het
Dgkb T C 12: 38,652,837 (GRCm39) probably null Het
Disc1 T C 8: 125,959,732 (GRCm39) V748A probably benign Het
Dmbt1 C G 7: 130,684,317 (GRCm39) D778E unknown Het
Dmxl2 T C 9: 54,291,037 (GRCm39) Y2471C probably benign Het
Fam185a T A 5: 21,643,814 (GRCm39) N243K probably benign Het
Fchsd2 A T 7: 100,902,780 (GRCm39) Q386L possibly damaging Het
Gm904 C A 13: 50,797,453 (GRCm39) P49Q probably damaging Het
H2-Q10 C T 17: 35,781,374 (GRCm39) R59C probably damaging Het
Ier5l A G 2: 30,363,105 (GRCm39) Y307H possibly damaging Het
Kmt2e C A 5: 23,702,090 (GRCm39) T906K probably benign Het
Kndc1 C T 7: 139,493,434 (GRCm39) R467W probably damaging Het
Muc5ac C A 7: 141,364,213 (GRCm39) T2508K probably damaging Het
Nlrp9a A T 7: 26,264,431 (GRCm39) M784L probably benign Het
Nlrp9b T A 7: 19,757,937 (GRCm39) C391* probably null Het
Nubp2 A C 17: 25,103,439 (GRCm39) M146R probably damaging Het
Or10q3 T A 19: 11,848,578 (GRCm39) M1L probably damaging Het
Or1a1b C T 11: 74,097,221 (GRCm39) V274M possibly damaging Het
Or2ag1b T A 7: 106,288,876 (GRCm39) S21C probably benign Het
Or2b2 G A 13: 21,888,085 (GRCm39) V305M probably benign Het
Or4k45 A T 2: 111,395,747 (GRCm39) L14H probably damaging Het
Or7e166 A T 9: 19,624,389 (GRCm39) N89Y probably benign Het
Otud1 T C 2: 19,663,189 (GRCm39) V106A possibly damaging Het
Pcdhac1 T A 18: 37,225,453 (GRCm39) Y755* probably null Het
Pkd1l3 C T 8: 110,350,520 (GRCm39) P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,119,477 (GRCm39) probably benign Het
Samhd1 T C 2: 156,941,353 (GRCm39) E648G probably benign Het
Smarca5 T C 8: 81,435,756 (GRCm39) T794A probably benign Het
Spc24 A T 9: 21,669,026 (GRCm39) L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Stra6l G A 4: 45,864,905 (GRCm39) R77Q probably damaging Het
Tdrd1 G A 19: 56,837,081 (GRCm39) V472M probably benign Het
Tsc2 A T 17: 24,823,961 (GRCm39) I948K possibly damaging Het
Ttc39d T C 17: 80,523,434 (GRCm39) V31A probably benign Het
Vmn1r158 A T 7: 22,489,305 (GRCm39) C301* probably null Het
Vmn2r22 A T 6: 123,614,486 (GRCm39) L368* probably null Het
Vmn2r79 A G 7: 86,651,308 (GRCm39) T236A probably benign Het
Vwa1 T C 4: 155,857,225 (GRCm39) H191R probably benign Het
Zdbf2 T A 1: 63,344,135 (GRCm39) V838E possibly damaging Het
Other mutations in Csnk1g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Csnk1g3 APN 18 54,052,075 (GRCm39) missense probably damaging 1.00
IGL02148:Csnk1g3 APN 18 54,086,360 (GRCm39) missense probably benign 0.11
IGL02379:Csnk1g3 APN 18 54,066,564 (GRCm39) missense probably benign 0.00
IGL02447:Csnk1g3 APN 18 54,028,942 (GRCm39) missense probably benign 0.26
IGL03172:Csnk1g3 APN 18 54,086,356 (GRCm39) missense possibly damaging 0.48
R0153:Csnk1g3 UTSW 18 54,051,861 (GRCm39) splice site probably benign
R0606:Csnk1g3 UTSW 18 54,050,100 (GRCm39) missense probably damaging 1.00
R1399:Csnk1g3 UTSW 18 54,028,982 (GRCm39) missense probably damaging 0.97
R1435:Csnk1g3 UTSW 18 54,039,746 (GRCm39) splice site probably null
R4829:Csnk1g3 UTSW 18 54,028,895 (GRCm39) missense possibly damaging 0.85
R5552:Csnk1g3 UTSW 18 54,065,355 (GRCm39) missense probably benign 0.04
R6305:Csnk1g3 UTSW 18 54,065,384 (GRCm39) nonsense probably null
R6556:Csnk1g3 UTSW 18 54,063,354 (GRCm39) missense possibly damaging 0.82
R7324:Csnk1g3 UTSW 18 54,052,090 (GRCm39) missense probably damaging 1.00
R7401:Csnk1g3 UTSW 18 54,063,390 (GRCm39) missense probably damaging 1.00
R7545:Csnk1g3 UTSW 18 54,028,897 (GRCm39) missense probably damaging 0.97
R7846:Csnk1g3 UTSW 18 54,081,177 (GRCm39) missense probably benign 0.03
R7968:Csnk1g3 UTSW 18 54,028,726 (GRCm39) start gained probably benign
R8215:Csnk1g3 UTSW 18 54,081,151 (GRCm39) missense probably benign 0.04
R8390:Csnk1g3 UTSW 18 54,081,150 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CATGCTTGGCTGACATGTTTTC -3'
(R):5'- ATTCAATGATGGGCAAAGCAC -3'

Sequencing Primer
(F):5'- CTCTCATCTGTCTTGCACGAG -3'
(R):5'- TGGGCAAAGCACTCGTG -3'
Posted On 2020-09-02