Incidental Mutation 'R8400:Olfr1419'
ID 647839
Institutional Source Beutler Lab
Gene Symbol Olfr1419
Ensembl Gene ENSMUSG00000067545
Gene Name olfactory receptor 1419
Synonyms MOR266-10, GA_x6K02T2RE5P-2222521-2221490
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 11868613-11875106 bp(-) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to A at 11871214 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000148848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087857] [ENSMUST00000213954] [ENSMUST00000217617]
AlphaFold Q7TQS2
Predicted Effect probably damaging
Transcript: ENSMUST00000087857
AA Change: M1L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000085163
Gene: ENSMUSG00000067545
AA Change: M1L

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 3.8e-55 PFAM
Pfam:7tm_1 41 291 2.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213954
AA Change: M1L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217617
AA Change: M1L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
C4bp C A 1: 130,636,747 C400F probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Csnk1g3 C T 18: 53,953,288 R422C probably benign Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
H2-Q10 C T 17: 35,470,477 R59C probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Samhd1 T C 2: 157,099,433 E648G probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Spc24 A T 9: 21,757,730 L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stra6l G A 4: 45,864,905 R77Q probably damaging Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Ttc39d T C 17: 80,216,005 V31A probably benign Het
Vmn1r158 A T 7: 22,789,880 C301* probably null Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vmn2r79 A G 7: 87,002,100 T236A probably benign Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in Olfr1419
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr1419 APN 19 11870524 missense probably benign 0.05
IGL01979:Olfr1419 APN 19 11871223 splice site probably benign
IGL02961:Olfr1419 APN 19 11870331 missense probably damaging 1.00
R0285:Olfr1419 UTSW 19 11871138 missense probably damaging 0.97
R0347:Olfr1419 UTSW 19 11870433 missense probably damaging 1.00
R1577:Olfr1419 UTSW 19 11870377 missense probably damaging 1.00
R2391:Olfr1419 UTSW 19 11870816 nonsense probably null
R3977:Olfr1419 UTSW 19 11870505 missense possibly damaging 0.82
R4660:Olfr1419 UTSW 19 11871048 missense possibly damaging 0.64
R5201:Olfr1419 UTSW 19 11870631 missense probably benign 0.21
R5995:Olfr1419 UTSW 19 11870862 missense possibly damaging 0.89
R6393:Olfr1419 UTSW 19 11870727 missense probably damaging 1.00
R7466:Olfr1419 UTSW 19 11870316 missense possibly damaging 0.94
R7828:Olfr1419 UTSW 19 11870805 missense probably damaging 1.00
R9644:Olfr1419 UTSW 19 11871210 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATGGAGGGAGTGATCCTGC -3'
(R):5'- CGGTGAGAAAGTTTTGCTCC -3'

Sequencing Primer
(F):5'- AGTGATCCTGCCAGACTGTGAG -3'
(R):5'- GGTAGCATATATCGAGACCCTCATG -3'
Posted On 2020-09-02