Incidental Mutation 'R7699:Emc1'
ID647861
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R7699 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139354870 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 94 (H94Q)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030513] [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000102503] [ENSMUST00000147999] [ENSMUST00000155257] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect probably benign
Transcript: ENSMUST00000030513
SMART Domains Protein: ENSMUSP00000030513
Gene: ENSMUSG00000028741

DomainStartEndE-ValueType
Pfam:Ribosomal_L10 18 121 7.9e-23 PFAM
low complexity region 222 238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042096
AA Change: H94Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: H94Q

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082262
AA Change: H94Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: H94Q

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102503
SMART Domains Protein: ENSMUSP00000099561
Gene: ENSMUSG00000028741

DomainStartEndE-ValueType
Pfam:Ribosomal_L10 18 121 4.6e-24 PFAM
low complexity region 223 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155257
SMART Domains Protein: ENSMUSP00000121453
Gene: ENSMUSG00000028741

DomainStartEndE-ValueType
Pfam:Ribosomal_L10 1 61 4.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably benign
Transcript: ENSMUST00000179784
AA Change: H94Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: H94Q

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,188,739 P638T probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Cacna1e A T 1: 154,443,928 I1404N probably damaging Het
Cdc42se1 A G 3: 95,232,597 N35D probably damaging Het
Cep290 A G 10: 100,540,369 S1447G probably benign Het
Chd6 T A 2: 161,025,943 H436L probably benign Het
Cnbd2 T C 2: 156,375,406 V605A probably benign Het
Col22a1 T A 15: 71,973,851 D354V probably damaging Het
Col25a1 T A 3: 130,522,479 probably null Het
Cttnbp2 T A 6: 18,514,735 M1L possibly damaging Het
Cux1 A T 5: 136,485,739 probably null Het
Cylc2 T A 4: 51,229,335 S226T unknown Het
Cyp4b1 T C 4: 115,641,965 D68G probably benign Het
Dicer1 A C 12: 104,705,170 L947R probably damaging Het
Dmp1 T C 5: 104,211,724 S89P probably damaging Het
Dpf1 A G 7: 29,311,607 K144E possibly damaging Het
Ep300 C T 15: 81,586,393 probably benign Het
Epha10 T C 4: 124,902,647 I383T Het
Epo T A 5: 137,485,176 E5D probably benign Het
Esp15 G A 17: 39,644,733 V64I possibly damaging Het
Fam126a A G 5: 23,915,496 S345P probably damaging Het
Fbxl18 A T 5: 142,885,749 V577E probably damaging Het
Fhl4 A T 10: 85,098,515 I134N probably benign Het
Fhl4 A T 10: 85,098,249 C223S probably damaging Het
Frmpd2 G T 14: 33,542,938 M891I probably benign Het
Gk2 T C 5: 97,456,398 I194V probably benign Het
Glt8d2 A C 10: 82,662,288 probably null Het
Gm12886 G C 4: 121,416,679 H113Q possibly damaging Het
Ighv1-36 A T 12: 114,880,026 Y71* probably null Het
Il18bp A G 7: 102,016,822 W50R probably damaging Het
Jmjd1c T A 10: 67,218,416 I33K probably benign Het
Lama5 C T 2: 180,180,861 A2833T probably damaging Het
Manea T G 4: 26,340,758 N68T probably benign Het
Map1a T C 2: 121,299,720 L339P probably damaging Het
Mblac1 A C 5: 138,194,657 D87A probably damaging Het
Mmp24 C T 2: 155,798,176 T142I probably damaging Het
Mpp2 T A 11: 102,059,435 H531L probably damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mx1 T A 16: 97,448,321 I339F unknown Het
Naip2 G A 13: 100,160,369 T1053I probably benign Het
Nckap1l A G 15: 103,462,821 probably null Het
Olfr1437 T C 19: 12,322,477 T117A probably benign Het
Olfr562-ps1 A G 7: 102,782,322 Y282C possibly damaging Het
Otud7b T C 3: 96,155,963 F840L probably damaging Het
Pdzd8 T C 19: 59,344,941 Y216C probably damaging Het
Pkd1l1 T A 11: 8,965,142 I133F Het
Plaur A G 7: 24,474,267 N221S possibly damaging Het
Plin4 T C 17: 56,103,828 T1068A probably benign Het
Plxnd1 T C 6: 115,959,794 D1659G probably damaging Het
Prpf8 T A 11: 75,500,196 M1357K probably benign Het
Prr36 G T 8: 4,213,989 T559N unknown Het
Prss46 A G 9: 110,849,554 M2V probably benign Het
Rbpms T A 8: 33,864,363 E51D probably damaging Het
Rere C T 4: 150,617,098 R328W Het
Retnla T A 16: 48,842,813 N26K probably benign Het
Rubcnl G A 14: 75,031,964 V21I probably benign Het
Safb T A 17: 56,601,504 S598R unknown Het
Sertad4 A G 1: 192,846,867 S214P possibly damaging Het
Sin3a C T 9: 57,110,654 Q786* probably null Het
Slc8a3 A C 12: 81,314,473 L524W probably damaging Het
Sp3 T C 2: 72,971,229 T191A probably benign Het
Sp9 T C 2: 73,273,380 S93P probably damaging Het
Tbrg1 A C 9: 37,649,475 H368Q probably benign Het
Tinagl1 T G 4: 130,168,039 Q198H probably benign Het
Usp19 C T 9: 108,496,172 R648* probably null Het
Vmn2r124 A G 17: 18,073,723 M691V probably benign Het
Vmn2r2 T A 3: 64,117,115 M682L possibly damaging Het
Vps13d T A 4: 145,085,405 H3344L Het
Vwa3a G A 7: 120,752,618 G35E probably damaging Het
Zfhx3 A G 8: 108,951,122 S2935G probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp758 C A 17: 22,375,665 Y377* probably null Het
Zfp952 A G 17: 33,002,009 K67R possibly damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGAAGCCTTAGCCGACTACC -3'
(R):5'- GCCATTTTCAAAAGCTGCTCAG -3'

Sequencing Primer
(F):5'- AGCCGACTACCCTTGAATTATC -3'
(R):5'- TCAAAAGCTGCTCAGTTGCG -3'
Posted On2020-09-02