Incidental Mutation 'R7699:Dmp1'
ID647866
Institutional Source Beutler Lab
Gene Symbol Dmp1
Ensembl Gene ENSMUSG00000029307
Gene Namedentin matrix protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7699 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104202613-104214102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104211724 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000068053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066708]
Predicted Effect probably damaging
Transcript: ENSMUST00000066708
AA Change: S89P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068053
Gene: ENSMUSG00000029307
AA Change: S89P

DomainStartEndE-ValueType
Pfam:DMP1 1 503 9.8e-206 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypophosphatemia, rickets, osteomalacia, renal phosphate-wasting, impaired osteocyte maturation, defective dentinogenesis, and severe alveolar bone and cementum defects leading to early periodontal breakdown. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,188,739 P638T probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Cacna1e A T 1: 154,443,928 I1404N probably damaging Het
Cdc42se1 A G 3: 95,232,597 N35D probably damaging Het
Cep290 A G 10: 100,540,369 S1447G probably benign Het
Chd6 T A 2: 161,025,943 H436L probably benign Het
Cnbd2 T C 2: 156,375,406 V605A probably benign Het
Col22a1 T A 15: 71,973,851 D354V probably damaging Het
Col25a1 T A 3: 130,522,479 probably null Het
Cttnbp2 T A 6: 18,514,735 M1L possibly damaging Het
Cux1 A T 5: 136,485,739 probably null Het
Cylc2 T A 4: 51,229,335 S226T unknown Het
Cyp4b1 T C 4: 115,641,965 D68G probably benign Het
Dicer1 A C 12: 104,705,170 L947R probably damaging Het
Dpf1 A G 7: 29,311,607 K144E possibly damaging Het
Emc1 T A 4: 139,354,870 H94Q probably benign Het
Ep300 C T 15: 81,586,393 probably benign Het
Epha10 T C 4: 124,902,647 I383T Het
Epo T A 5: 137,485,176 E5D probably benign Het
Esp15 G A 17: 39,644,733 V64I possibly damaging Het
Fam126a A G 5: 23,915,496 S345P probably damaging Het
Fbxl18 A T 5: 142,885,749 V577E probably damaging Het
Fhl4 A T 10: 85,098,249 C223S probably damaging Het
Fhl4 A T 10: 85,098,515 I134N probably benign Het
Frmpd2 G T 14: 33,542,938 M891I probably benign Het
Gk2 T C 5: 97,456,398 I194V probably benign Het
Glt8d2 A C 10: 82,662,288 probably null Het
Gm12886 G C 4: 121,416,679 H113Q possibly damaging Het
Ighv1-36 A T 12: 114,880,026 Y71* probably null Het
Il18bp A G 7: 102,016,822 W50R probably damaging Het
Jmjd1c T A 10: 67,218,416 I33K probably benign Het
Lama5 C T 2: 180,180,861 A2833T probably damaging Het
Manea T G 4: 26,340,758 N68T probably benign Het
Map1a T C 2: 121,299,720 L339P probably damaging Het
Mblac1 A C 5: 138,194,657 D87A probably damaging Het
Mmp24 C T 2: 155,798,176 T142I probably damaging Het
Mpp2 T A 11: 102,059,435 H531L probably damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mx1 T A 16: 97,448,321 I339F unknown Het
Naip2 G A 13: 100,160,369 T1053I probably benign Het
Nckap1l A G 15: 103,462,821 probably null Het
Olfr1437 T C 19: 12,322,477 T117A probably benign Het
Olfr562-ps1 A G 7: 102,782,322 Y282C possibly damaging Het
Otud7b T C 3: 96,155,963 F840L probably damaging Het
Pdzd8 T C 19: 59,344,941 Y216C probably damaging Het
Pkd1l1 T A 11: 8,965,142 I133F Het
Plaur A G 7: 24,474,267 N221S possibly damaging Het
Plin4 T C 17: 56,103,828 T1068A probably benign Het
Plxnd1 T C 6: 115,959,794 D1659G probably damaging Het
Prpf8 T A 11: 75,500,196 M1357K probably benign Het
Prr36 G T 8: 4,213,989 T559N unknown Het
Prss46 A G 9: 110,849,554 M2V probably benign Het
Rbpms T A 8: 33,864,363 E51D probably damaging Het
Rere C T 4: 150,617,098 R328W Het
Retnla T A 16: 48,842,813 N26K probably benign Het
Rubcnl G A 14: 75,031,964 V21I probably benign Het
Safb T A 17: 56,601,504 S598R unknown Het
Sertad4 A G 1: 192,846,867 S214P possibly damaging Het
Sin3a C T 9: 57,110,654 Q786* probably null Het
Slc8a3 A C 12: 81,314,473 L524W probably damaging Het
Sp3 T C 2: 72,971,229 T191A probably benign Het
Sp9 T C 2: 73,273,380 S93P probably damaging Het
Tbrg1 A C 9: 37,649,475 H368Q probably benign Het
Tinagl1 T G 4: 130,168,039 Q198H probably benign Het
Usp19 C T 9: 108,496,172 R648* probably null Het
Vmn2r124 A G 17: 18,073,723 M691V probably benign Het
Vmn2r2 T A 3: 64,117,115 M682L possibly damaging Het
Vps13d T A 4: 145,085,405 H3344L Het
Vwa3a G A 7: 120,752,618 G35E probably damaging Het
Zfhx3 A G 8: 108,951,122 S2935G probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp758 C A 17: 22,375,665 Y377* probably null Het
Zfp952 A G 17: 33,002,009 K67R possibly damaging Het
Other mutations in Dmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dmp1 APN 5 104210155 splice site probably benign
IGL01063:Dmp1 APN 5 104207099 start codon destroyed probably null 0.73
IGL01599:Dmp1 APN 5 104212462 nonsense probably null
IGL01631:Dmp1 APN 5 104212868 missense probably benign 0.04
IGL01646:Dmp1 APN 5 104211865 missense probably damaging 1.00
IGL02611:Dmp1 APN 5 104212514 missense probably damaging 1.00
IGL02642:Dmp1 APN 5 104211670 missense probably damaging 0.97
choppers UTSW 5 104207125 missense probably damaging 1.00
R0197:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R0494:Dmp1 UTSW 5 104212208 missense probably damaging 1.00
R0529:Dmp1 UTSW 5 104212226 missense probably benign 0.03
R0850:Dmp1 UTSW 5 104212787 missense possibly damaging 0.86
R0883:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R1858:Dmp1 UTSW 5 104207630 missense possibly damaging 0.92
R1869:Dmp1 UTSW 5 104212076 missense probably damaging 1.00
R1995:Dmp1 UTSW 5 104209913 missense possibly damaging 0.60
R2004:Dmp1 UTSW 5 104211924 missense possibly damaging 0.73
R2009:Dmp1 UTSW 5 104212840 missense probably damaging 0.97
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R4716:Dmp1 UTSW 5 104212561 missense probably damaging 0.99
R5687:Dmp1 UTSW 5 104207086 start gained probably benign
R6331:Dmp1 UTSW 5 104207125 missense probably damaging 1.00
R6389:Dmp1 UTSW 5 104212922 missense probably damaging 1.00
R7006:Dmp1 UTSW 5 104212322 missense probably benign 0.02
R7103:Dmp1 UTSW 5 104211863 missense probably damaging 1.00
R8181:Dmp1 UTSW 5 104211514 splice site probably null
R8350:Dmp1 UTSW 5 104212899 missense probably damaging 0.99
R8379:Dmp1 UTSW 5 104211705 nonsense probably null
R8450:Dmp1 UTSW 5 104212899 missense probably damaging 0.99
R8531:Dmp1 UTSW 5 104212403 missense probably damaging 1.00
Z1177:Dmp1 UTSW 5 104211652 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGGGAGGGATTTTGGAGCC -3'
(R):5'- ATCTTGGGCACTGTTTTCTTGAG -3'

Sequencing Primer
(F):5'- GGATTTTGGAGCCTAGGGAAG -3'
(R):5'- AGAGGTGCTGTCTTCACTGGAC -3'
Posted On2020-09-02