Incidental Mutation 'R7699:Plxnd1'
ID647872
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Nameplexin D1
Synonymsb2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7699 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location115954811-115995005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115959794 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1659 (D1659G)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
Predicted Effect probably damaging
Transcript: ENSMUST00000015511
AA Change: D1659G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: D1659G

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Meta Mutation Damage Score 0.1599 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,188,739 P638T probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Cacna1e A T 1: 154,443,928 I1404N probably damaging Het
Cdc42se1 A G 3: 95,232,597 N35D probably damaging Het
Cep290 A G 10: 100,540,369 S1447G probably benign Het
Chd6 T A 2: 161,025,943 H436L probably benign Het
Cnbd2 T C 2: 156,375,406 V605A probably benign Het
Col22a1 T A 15: 71,973,851 D354V probably damaging Het
Col25a1 T A 3: 130,522,479 probably null Het
Cttnbp2 T A 6: 18,514,735 M1L possibly damaging Het
Cux1 A T 5: 136,485,739 probably null Het
Cylc2 T A 4: 51,229,335 S226T unknown Het
Cyp4b1 T C 4: 115,641,965 D68G probably benign Het
Dicer1 A C 12: 104,705,170 L947R probably damaging Het
Dmp1 T C 5: 104,211,724 S89P probably damaging Het
Dpf1 A G 7: 29,311,607 K144E possibly damaging Het
Emc1 T A 4: 139,354,870 H94Q probably benign Het
Ep300 C T 15: 81,586,393 probably benign Het
Epha10 T C 4: 124,902,647 I383T Het
Epo T A 5: 137,485,176 E5D probably benign Het
Esp15 G A 17: 39,644,733 V64I possibly damaging Het
Fam126a A G 5: 23,915,496 S345P probably damaging Het
Fbxl18 A T 5: 142,885,749 V577E probably damaging Het
Fhl4 A T 10: 85,098,515 I134N probably benign Het
Fhl4 A T 10: 85,098,249 C223S probably damaging Het
Frmpd2 G T 14: 33,542,938 M891I probably benign Het
Gk2 T C 5: 97,456,398 I194V probably benign Het
Glt8d2 A C 10: 82,662,288 probably null Het
Gm12886 G C 4: 121,416,679 H113Q possibly damaging Het
Ighv1-36 A T 12: 114,880,026 Y71* probably null Het
Il18bp A G 7: 102,016,822 W50R probably damaging Het
Jmjd1c T A 10: 67,218,416 I33K probably benign Het
Lama5 C T 2: 180,180,861 A2833T probably damaging Het
Manea T G 4: 26,340,758 N68T probably benign Het
Map1a T C 2: 121,299,720 L339P probably damaging Het
Mblac1 A C 5: 138,194,657 D87A probably damaging Het
Mmp24 C T 2: 155,798,176 T142I probably damaging Het
Mpp2 T A 11: 102,059,435 H531L probably damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mx1 T A 16: 97,448,321 I339F unknown Het
Naip2 G A 13: 100,160,369 T1053I probably benign Het
Nckap1l A G 15: 103,462,821 probably null Het
Olfr1437 T C 19: 12,322,477 T117A probably benign Het
Olfr562-ps1 A G 7: 102,782,322 Y282C possibly damaging Het
Otud7b T C 3: 96,155,963 F840L probably damaging Het
Pdzd8 T C 19: 59,344,941 Y216C probably damaging Het
Pkd1l1 T A 11: 8,965,142 I133F Het
Plaur A G 7: 24,474,267 N221S possibly damaging Het
Plin4 T C 17: 56,103,828 T1068A probably benign Het
Prpf8 T A 11: 75,500,196 M1357K probably benign Het
Prr36 G T 8: 4,213,989 T559N unknown Het
Prss46 A G 9: 110,849,554 M2V probably benign Het
Rbpms T A 8: 33,864,363 E51D probably damaging Het
Rere C T 4: 150,617,098 R328W Het
Retnla T A 16: 48,842,813 N26K probably benign Het
Rubcnl G A 14: 75,031,964 V21I probably benign Het
Safb T A 17: 56,601,504 S598R unknown Het
Sertad4 A G 1: 192,846,867 S214P possibly damaging Het
Sin3a C T 9: 57,110,654 Q786* probably null Het
Slc8a3 A C 12: 81,314,473 L524W probably damaging Het
Sp3 T C 2: 72,971,229 T191A probably benign Het
Sp9 T C 2: 73,273,380 S93P probably damaging Het
Tbrg1 A C 9: 37,649,475 H368Q probably benign Het
Tinagl1 T G 4: 130,168,039 Q198H probably benign Het
Usp19 C T 9: 108,496,172 R648* probably null Het
Vmn2r124 A G 17: 18,073,723 M691V probably benign Het
Vmn2r2 T A 3: 64,117,115 M682L possibly damaging Het
Vps13d T A 4: 145,085,405 H3344L Het
Vwa3a G A 7: 120,752,618 G35E probably damaging Het
Zfhx3 A G 8: 108,951,122 S2935G probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp758 C A 17: 22,375,665 Y377* probably null Het
Zfp952 A G 17: 33,002,009 K67R possibly damaging Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGCTGTAGCTGCTGGAAGC -3'
(R):5'- ATGGTTTGCCTCGAGTACC -3'

Sequencing Primer
(F):5'- CAATCAGCTTTTCTCTAGCAGCATGG -3'
(R):5'- TTTGCCTCGAGTACCCAGAG -3'
Posted On2020-09-02