Mutagenetix > Incidental Mutation

Incidental Mutation 'R7699:Slc8a3'

647895

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7699 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 81314473 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Tryptophan at position 524 (L524W)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: L524W

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: L524W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: L524W

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: L524W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: L524W

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Meta Mutation Damage Score

0.2776

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts7	C	A	9: 90,188,739	P638T	probably damaging	Het
BC005537	C	T	13: 24,803,399	R7W	possibly damaging	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Cacna1e	A	T	1: 154,443,928	I1404N	probably damaging	Het
Cdc42se1	A	G	3: 95,232,597	N35D	probably damaging	Het
Cep290	A	G	10: 100,540,369	S1447G	probably benign	Het
Chd6	T	A	2: 161,025,943	H436L	probably benign	Het
Cnbd2	T	C	2: 156,375,406	V605A	probably benign	Het
Col22a1	T	A	15: 71,973,851	D354V	probably damaging	Het
Col25a1	T	A	3: 130,522,479		probably null	Het
Cttnbp2	T	A	6: 18,514,735	M1L	possibly damaging	Het
Cux1	A	T	5: 136,485,739		probably null	Het
Cylc2	T	A	4: 51,229,335	S226T	unknown	Het
Cyp4b1	T	C	4: 115,641,965	D68G	probably benign	Het
Dicer1	A	C	12: 104,705,170	L947R	probably damaging	Het
Dmp1	T	C	5: 104,211,724	S89P	probably damaging	Het
Dpf1	A	G	7: 29,311,607	K144E	possibly damaging	Het
Emc1	T	A	4: 139,354,870	H94Q	probably benign	Het
Ep300	C	T	15: 81,586,393		probably benign	Het
Epha10	T	C	4: 124,902,647	I383T		Het
Epo	T	A	5: 137,485,176	E5D	probably benign	Het
Esp15	G	A	17: 39,644,733	V64I	possibly damaging	Het
Fam126a	A	G	5: 23,915,496	S345P	probably damaging	Het
Fbxl18	A	T	5: 142,885,749	V577E	probably damaging	Het
Fhl4	A	T	10: 85,098,249	C223S	probably damaging	Het
Fhl4	A	T	10: 85,098,515	I134N	probably benign	Het
Frmpd2	G	T	14: 33,542,938	M891I	probably benign	Het
Gk2	T	C	5: 97,456,398	I194V	probably benign	Het
Glt8d2	A	C	10: 82,662,288		probably null	Het
Gm12886	G	C	4: 121,416,679	H113Q	possibly damaging	Het
Ighv1-36	A	T	12: 114,880,026	Y71*	probably null	Het
Il18bp	A	G	7: 102,016,822	W50R	probably damaging	Het
Jmjd1c	T	A	10: 67,218,416	I33K	probably benign	Het
Lama5	C	T	2: 180,180,861	A2833T	probably damaging	Het
Manea	T	G	4: 26,340,758	N68T	probably benign	Het
Map1a	T	C	2: 121,299,720	L339P	probably damaging	Het
Mblac1	A	C	5: 138,194,657	D87A	probably damaging	Het
Mmp24	C	T	2: 155,798,176	T142I	probably damaging	Het
Mpp2	T	A	11: 102,059,435	H531L	probably damaging	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Mx1	T	A	16: 97,448,321	I339F	unknown	Het
Naip2	G	A	13: 100,160,369	T1053I	probably benign	Het
Nckap1l	A	G	15: 103,462,821		probably null	Het
Olfr1437	T	C	19: 12,322,477	T117A	probably benign	Het
Olfr562-ps1	A	G	7: 102,782,322	Y282C	possibly damaging	Het
Otud7b	T	C	3: 96,155,963	F840L	probably damaging	Het
Pdzd8	T	C	19: 59,344,941	Y216C	probably damaging	Het
Pkd1l1	T	A	11: 8,965,142	I133F		Het
Plaur	A	G	7: 24,474,267	N221S	possibly damaging	Het
Plin4	T	C	17: 56,103,828	T1068A	probably benign	Het
Plxnd1	T	C	6: 115,959,794	D1659G	probably damaging	Het
Prpf8	T	A	11: 75,500,196	M1357K	probably benign	Het
Prr36	G	T	8: 4,213,989	T559N	unknown	Het
Prss46	A	G	9: 110,849,554	M2V	probably benign	Het
Rbpms	T	A	8: 33,864,363	E51D	probably damaging	Het
Rere	C	T	4: 150,617,098	R328W		Het
Retnla	T	A	16: 48,842,813	N26K	probably benign	Het
Rubcnl	G	A	14: 75,031,964	V21I	probably benign	Het
Safb	T	A	17: 56,601,504	S598R	unknown	Het
Sertad4	A	G	1: 192,846,867	S214P	possibly damaging	Het
Sin3a	C	T	9: 57,110,654	Q786*	probably null	Het
Sp3	T	C	2: 72,971,229	T191A	probably benign	Het
Sp9	T	C	2: 73,273,380	S93P	probably damaging	Het
Tbrg1	A	C	9: 37,649,475	H368Q	probably benign	Het
Tinagl1	T	G	4: 130,168,039	Q198H	probably benign	Het
Usp19	C	T	9: 108,496,172	R648*	probably null	Het
Vmn2r124	A	G	17: 18,073,723	M691V	probably benign	Het
Vmn2r2	T	A	3: 64,117,115	M682L	possibly damaging	Het
Vps13d	T	A	4: 145,085,405	H3344L		Het
Vwa3a	G	A	7: 120,752,618	G35E	probably damaging	Het
Zfhx3	A	G	8: 108,951,122	S2935G	probably benign	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp758	C	A	17: 22,375,665	Y377*	probably null	Het
Zfp952	A	G	17: 33,002,009	K67R	possibly damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- ATATGCATCTTCAAAGTCCTCGC -3'
(R):5'- CACTGTGGTTCTGAAGCCAG -3'

Sequencing Primer
(F):5'- TCTTCAAAGTCCTCGCCACCAC -3'
(R):5'- ACCCAGAAGGAGTTCTCTGTG -3'

Posted On

2020-09-02