Incidental Mutation 'R7699:Pdzd8'
ID647913
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7699 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59344941 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 216 (Y216C)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099274]
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: Y216C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: Y216C

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,188,739 P638T probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Cacna1e A T 1: 154,443,928 I1404N probably damaging Het
Cdc42se1 A G 3: 95,232,597 N35D probably damaging Het
Cep290 A G 10: 100,540,369 S1447G probably benign Het
Chd6 T A 2: 161,025,943 H436L probably benign Het
Cnbd2 T C 2: 156,375,406 V605A probably benign Het
Col22a1 T A 15: 71,973,851 D354V probably damaging Het
Col25a1 T A 3: 130,522,479 probably null Het
Cttnbp2 T A 6: 18,514,735 M1L possibly damaging Het
Cux1 A T 5: 136,485,739 probably null Het
Cylc2 T A 4: 51,229,335 S226T unknown Het
Cyp4b1 T C 4: 115,641,965 D68G probably benign Het
Dicer1 A C 12: 104,705,170 L947R probably damaging Het
Dmp1 T C 5: 104,211,724 S89P probably damaging Het
Dpf1 A G 7: 29,311,607 K144E possibly damaging Het
Emc1 T A 4: 139,354,870 H94Q probably benign Het
Ep300 C T 15: 81,586,393 probably benign Het
Epha10 T C 4: 124,902,647 I383T Het
Epo T A 5: 137,485,176 E5D probably benign Het
Esp15 G A 17: 39,644,733 V64I possibly damaging Het
Fam126a A G 5: 23,915,496 S345P probably damaging Het
Fbxl18 A T 5: 142,885,749 V577E probably damaging Het
Fhl4 A T 10: 85,098,249 C223S probably damaging Het
Fhl4 A T 10: 85,098,515 I134N probably benign Het
Frmpd2 G T 14: 33,542,938 M891I probably benign Het
Gk2 T C 5: 97,456,398 I194V probably benign Het
Glt8d2 A C 10: 82,662,288 probably null Het
Gm12886 G C 4: 121,416,679 H113Q possibly damaging Het
Ighv1-36 A T 12: 114,880,026 Y71* probably null Het
Il18bp A G 7: 102,016,822 W50R probably damaging Het
Jmjd1c T A 10: 67,218,416 I33K probably benign Het
Lama5 C T 2: 180,180,861 A2833T probably damaging Het
Manea T G 4: 26,340,758 N68T probably benign Het
Map1a T C 2: 121,299,720 L339P probably damaging Het
Mblac1 A C 5: 138,194,657 D87A probably damaging Het
Mmp24 C T 2: 155,798,176 T142I probably damaging Het
Mpp2 T A 11: 102,059,435 H531L probably damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mx1 T A 16: 97,448,321 I339F unknown Het
Naip2 G A 13: 100,160,369 T1053I probably benign Het
Nckap1l A G 15: 103,462,821 probably null Het
Olfr1437 T C 19: 12,322,477 T117A probably benign Het
Olfr562-ps1 A G 7: 102,782,322 Y282C possibly damaging Het
Otud7b T C 3: 96,155,963 F840L probably damaging Het
Pkd1l1 T A 11: 8,965,142 I133F Het
Plaur A G 7: 24,474,267 N221S possibly damaging Het
Plin4 T C 17: 56,103,828 T1068A probably benign Het
Plxnd1 T C 6: 115,959,794 D1659G probably damaging Het
Prpf8 T A 11: 75,500,196 M1357K probably benign Het
Prr36 G T 8: 4,213,989 T559N unknown Het
Prss46 A G 9: 110,849,554 M2V probably benign Het
Rbpms T A 8: 33,864,363 E51D probably damaging Het
Rere C T 4: 150,617,098 R328W Het
Retnla T A 16: 48,842,813 N26K probably benign Het
Rubcnl G A 14: 75,031,964 V21I probably benign Het
Safb T A 17: 56,601,504 S598R unknown Het
Sertad4 A G 1: 192,846,867 S214P possibly damaging Het
Sin3a C T 9: 57,110,654 Q786* probably null Het
Slc8a3 A C 12: 81,314,473 L524W probably damaging Het
Sp3 T C 2: 72,971,229 T191A probably benign Het
Sp9 T C 2: 73,273,380 S93P probably damaging Het
Tbrg1 A C 9: 37,649,475 H368Q probably benign Het
Tinagl1 T G 4: 130,168,039 Q198H probably benign Het
Usp19 C T 9: 108,496,172 R648* probably null Het
Vmn2r124 A G 17: 18,073,723 M691V probably benign Het
Vmn2r2 T A 3: 64,117,115 M682L possibly damaging Het
Vps13d T A 4: 145,085,405 H3344L Het
Vwa3a G A 7: 120,752,618 G35E probably damaging Het
Zfhx3 A G 8: 108,951,122 S2935G probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp758 C A 17: 22,375,665 Y377* probably null Het
Zfp952 A G 17: 33,002,009 K67R possibly damaging Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
Eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
keep UTSW 19 59301351 nonsense probably null
Stronghold UTSW 19 59345352 nonsense probably null
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
R7751:Pdzd8 UTSW 19 59344776 missense probably damaging 0.98
R7759:Pdzd8 UTSW 19 59299926 missense probably damaging 1.00
R7784:Pdzd8 UTSW 19 59327863 missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59345086 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTGATCTTGTAACTGGGCAG -3'
(R):5'- TCATCAAGACCATCCGGCTG -3'

Sequencing Primer
(F):5'- CGCTTGATGATCTTCTTGAGC -3'
(R):5'- GGAGCTGGCCTTTGAAG -3'
Posted On2020-09-02