Incidental Mutation 'R8154:Miga1'
ID647922
Institutional Source Beutler Lab
Gene Symbol Miga1
Ensembl Gene ENSMUSG00000054942
Gene Namemitoguardin 1
SynonymsC030011O14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8154 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location152273849-152340407 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 152320700 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000068243] [ENSMUST00000073089] [ENSMUST00000196265] [ENSMUST00000199334]
Predicted Effect silent
Transcript: ENSMUST00000068243
SMART Domains Protein: ENSMUSP00000068261
Gene: ENSMUSG00000054942

DomainStartEndE-ValueType
Pfam:DUF2217 26 306 6.3e-74 PFAM
Pfam:DUF2217 298 507 2.8e-115 PFAM
Predicted Effect silent
Transcript: ENSMUST00000073089
SMART Domains Protein: ENSMUSP00000072836
Gene: ENSMUSG00000054942

DomainStartEndE-ValueType
Pfam:DUF2217 27 571 4.8e-245 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000196265
AA Change: L153P
SMART Domains Protein: ENSMUSP00000142667
Gene: ENSMUSG00000054942
AA Change: L153P

DomainStartEndE-ValueType
Pfam:DUF2217 26 146 1.5e-19 PFAM
Predicted Effect silent
Transcript: ENSMUST00000199334
SMART Domains Protein: ENSMUSP00000143238
Gene: ENSMUSG00000054942

DomainStartEndE-ValueType
Pfam:DUF2217 26 496 1.2e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199443
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810037I17Rik G T 3: 122,924,493 G12C probably damaging Het
Adamts10 C A 17: 33,537,928 P357T probably damaging Het
Bmyc T A 2: 25,707,334 S137T probably damaging Het
Bpifa1 T A 2: 154,145,734 M168K possibly damaging Het
C530008M17Rik A T 5: 76,841,797 E62D unknown Het
Card11 T G 5: 140,900,977 K339T probably damaging Het
Ccdc149 C T 5: 52,385,104 probably null Het
Ccr9 T C 9: 123,779,831 S193P probably benign Het
Csf2rb A G 15: 78,340,442 probably null Het
Cux1 T C 5: 136,252,580 E576G probably damaging Het
Cyp4a30b A G 4: 115,458,296 N238S probably benign Het
D430042O09Rik T C 7: 125,813,630 L382P probably damaging Het
Dnaja3 C A 16: 4,699,876 T375K possibly damaging Het
Espnl C T 1: 91,325,199 H217Y possibly damaging Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Fcgbp A G 7: 28,085,082 D189G probably benign Het
Gle1 T A 2: 29,938,607 probably null Het
Gm5346 A T 8: 43,625,387 I600N probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gtf2i A T 5: 134,251,867 F583L probably benign Het
Heatr9 T A 11: 83,511,877 Y532F possibly damaging Het
Hic2 C T 16: 17,258,480 S391L probably benign Het
Hipk1 A G 3: 103,749,336 V905A probably damaging Het
Inpp5f T G 7: 128,664,267 W211G possibly damaging Het
Kcnma1 T A 14: 23,311,754 Y1123F possibly damaging Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Lmod3 T A 6: 97,247,980 K293N probably damaging Het
Luzp1 T C 4: 136,541,884 S473P possibly damaging Het
Lzic T A 4: 149,488,684 F98I probably damaging Het
Map4k4 T G 1: 40,021,142 Y1030* probably null Het
Mrpl18 T C 17: 12,911,721 E167G probably damaging Het
Myh4 A G 11: 67,253,374 E1190G probably damaging Het
Ngef C T 1: 87,540,760 M92I probably benign Het
Nlrc4 T A 17: 74,445,909 Y493F probably damaging Het
Olfr601 A C 7: 103,358,556 C213G probably benign Het
Otud7a C A 7: 63,757,864 F638L probably benign Het
Padi2 T A 4: 140,924,309 probably null Het
Pcdhgb1 A G 18: 37,682,543 I696V probably damaging Het
Pikfyve T C 1: 65,265,789 F1745S probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prrc2b C T 2: 32,218,677 A1637V probably benign Het
Rab3il1 A T 19: 10,027,572 M57L possibly damaging Het
Rbl2 A G 8: 91,107,197 D885G probably damaging Het
Rbm25 A G 12: 83,644,431 M47V unknown Het
Rd3l T A 12: 111,980,204 H46L probably benign Het
Scn5a C G 9: 119,562,545 R27P possibly damaging Het
Set T A 2: 30,069,088 V99D probably benign Het
Sh3tc1 T A 5: 35,718,352 I138F probably damaging Het
Slf2 T A 19: 44,935,157 S137T possibly damaging Het
Smg8 A T 11: 87,085,237 M506K possibly damaging Het
Stpg2 G A 3: 139,309,177 V368M probably damaging Het
Trav16d-dv11 T C 14: 53,047,542 V25A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Vrk1 A G 12: 106,070,534 K360E probably benign Het
Xirp2 T A 2: 67,511,673 H1419Q possibly damaging Het
Yes1 T C 5: 32,645,022 F94L probably damaging Het
Zc2hc1c T C 12: 85,290,172 L201P probably benign Het
Zfp638 C T 6: 83,977,409 R1499W probably damaging Het
Znfx1 A T 2: 167,055,237 L589Q probably damaging Het
Other mutations in Miga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Miga1 APN 3 152276690 missense probably benign 0.18
IGL01461:Miga1 APN 3 152335297 missense probably damaging 1.00
IGL02962:Miga1 APN 3 152285341 splice site probably benign
R0165:Miga1 UTSW 3 152290843 missense probably damaging 0.99
R0945:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1527:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1769:Miga1 UTSW 3 152287554 missense probably damaging 1.00
R1978:Miga1 UTSW 3 152335304 frame shift probably null
R3697:Miga1 UTSW 3 152322436 missense probably damaging 0.99
R4649:Miga1 UTSW 3 152279005 missense probably benign 0.28
R4660:Miga1 UTSW 3 152287518 missense probably damaging 1.00
R4679:Miga1 UTSW 3 152322475 missense probably damaging 1.00
R4815:Miga1 UTSW 3 152290806 missense probably benign 0.00
R5019:Miga1 UTSW 3 152322461 missense possibly damaging 0.86
R5488:Miga1 UTSW 3 152333446 small deletion probably benign
R6107:Miga1 UTSW 3 152335399 missense probably benign 0.03
R6227:Miga1 UTSW 3 152278949 missense probably benign 0.09
R6292:Miga1 UTSW 3 152317719 missense probably benign 0.30
R6438:Miga1 UTSW 3 152322403 missense probably damaging 1.00
R6444:Miga1 UTSW 3 152283831 missense probably damaging 1.00
R6489:Miga1 UTSW 3 152279008 missense probably damaging 0.99
R6564:Miga1 UTSW 3 152285322 missense probably damaging 1.00
R7354:Miga1 UTSW 3 152290500 missense probably damaging 1.00
R7440:Miga1 UTSW 3 152338046 critical splice acceptor site probably null
R7638:Miga1 UTSW 3 152276687 missense probably benign 0.00
R8039:Miga1 UTSW 3 152276756 missense probably benign 0.15
R8418:Miga1 UTSW 3 152285317 missense probably damaging 1.00
R8423:Miga1 UTSW 3 152322408 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGCTGTAGAATAGAACTGCC -3'
(R):5'- AGTCTAACTCCTGGTTCATTACATC -3'

Sequencing Primer
(F):5'- CCACAGAAAAGGAGGCTCTGC -3'
(R):5'- CGGCCCTTTAAAGTTCCTGATAGAG -3'
Posted On2020-09-11