Incidental Mutation 'R8152:Adgrb3'
ID647924
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R8152 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 25221757 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect probably null
Transcript: ENSMUST00000041838
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126626
SMART Domains Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
Pfam:7tm_2 4 273 7.3e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135518
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146592
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151309
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 92.4%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,458 L195P probably damaging Het
Adgrb1 T C 15: 74,541,611 V548A probably benign Het
Adgrb1 T C 15: 74,545,000 I752T probably damaging Het
Adh6a G T 3: 138,327,514 probably null Het
Aldh18a1 A G 19: 40,565,012 S431P probably benign Het
Arap3 T C 18: 37,991,357 R310G possibly damaging Het
Atad5 T C 11: 80,095,170 V361A possibly damaging Het
Atp8a1 C A 5: 67,762,582 M380I Het
Calcrl C T 2: 84,339,249 V363M possibly damaging Het
Camsap1 G T 2: 25,940,241 D490E probably damaging Het
Cd72 T A 4: 43,452,601 I131F possibly damaging Het
Cdh2 C T 18: 16,629,519 G513D probably benign Het
Cela1 T C 15: 100,682,941 T145A probably benign Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfap99 C T 5: 34,323,391 R462C probably damaging Het
Cmtm1 A G 8: 104,309,941 S19P possibly damaging Het
Crebbp A T 16: 4,085,081 M2098K possibly damaging Het
Csmd3 T C 15: 47,669,464 probably null Het
Ctsm C G 13: 61,539,649 V100L probably benign Het
Cyp2c67 C A 19: 39,640,008 C164F probably benign Het
Cyp2d11 T C 15: 82,392,487 I84V probably benign Het
Cyp2j11 T C 4: 96,307,292 D389G probably damaging Het
Dctd A G 8: 48,111,690 D9G probably benign Het
Fam221a C A 6: 49,378,556 F197L probably damaging Het
Fbxl4 T G 4: 22,427,225 C489G possibly damaging Het
Fmn1 C T 2: 113,365,692 T579M unknown Het
Fndc3a G A 14: 72,574,380 L337F probably damaging Het
Frmpd2 A G 14: 33,543,287 probably null Het
Gdnf C T 15: 7,834,762 S218L probably damaging Het
Gen1 A G 12: 11,243,265 F444L probably damaging Het
Gk5 A T 9: 96,174,703 D391V probably damaging Het
Gys2 T C 6: 142,427,410 T612A probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Isx T C 8: 74,889,999 F85L probably damaging Het
Kcnh5 T C 12: 74,897,859 D872G possibly damaging Het
Kif26b T G 1: 178,679,229 V290G possibly damaging Het
Ksr2 T C 5: 117,671,458 C429R probably damaging Het
Loxhd1 A C 18: 77,388,399 I1121L possibly damaging Het
Map2 T C 1: 66,414,743 F931L probably benign Het
Marc2 T A 1: 184,841,312 M130L possibly damaging Het
Mepce T C 5: 137,784,673 I464V probably benign Het
Mpo G T 11: 87,801,649 V538L probably benign Het
Myom1 T C 17: 71,084,295 V933A probably damaging Het
Nckap1l T G 15: 103,478,530 probably null Het
Ncmap C A 4: 135,377,064 M19I possibly damaging Het
Neb T A 2: 52,183,836 I5920F probably benign Het
Nnt C T 13: 119,374,676 V355I probably benign Het
Nr1i2 C T 16: 38,252,964 G217S probably damaging Het
Nsd1 A G 13: 55,310,367 R2098G possibly damaging Het
Parp4 A G 14: 56,647,246 T1261A probably benign Het
Pcgf3 A T 5: 108,487,857 N131I probably benign Het
Plcb2 C T 2: 118,710,821 D1012N probably benign Het
Plcl2 T C 17: 50,607,661 I566T probably damaging Het
Plekha1 G A 7: 130,908,372 A283T probably damaging Het
Prag1 A T 8: 36,099,925 M77L possibly damaging Het
Rhbdl2 A T 4: 123,824,918 I222L probably benign Het
Rnh1 A C 7: 141,160,704 V446G probably damaging Het
Sash1 C T 10: 8,751,041 R193H possibly damaging Het
Sgf29 G T 7: 126,672,654 V284L possibly damaging Het
Skiv2l2 T A 13: 112,872,983 K961* probably null Het
Slc12a3 G A 8: 94,330,384 G95D probably benign Het
Slc17a7 T C 7: 45,170,290 V172A probably damaging Het
Spta1 T C 1: 174,217,944 V1556A probably benign Het
Tex15 G A 8: 33,572,893 E784K possibly damaging Het
Ttn T C 2: 76,842,788 E11224G unknown Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zdbf2 C T 1: 63,306,413 T1317I possibly damaging Het
Zfat C T 15: 68,101,506 A1147T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zhx3 T G 2: 160,780,775 I491L probably benign Het
Zranb3 T C 1: 127,954,995 D1061G probably damaging Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25826085 missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25131269 missense probably damaging 1.00
R7292:Adgrb3 UTSW 1 25531876 missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25532630 missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25531919 nonsense probably null
R7489:Adgrb3 UTSW 1 25547505 missense probably damaging 1.00
R7615:Adgrb3 UTSW 1 25098897 missense probably damaging 1.00
R7623:Adgrb3 UTSW 1 25547548 missense probably damaging 1.00
R7787:Adgrb3 UTSW 1 25432544 missense probably damaging 1.00
R7837:Adgrb3 UTSW 1 25128834 missense probably damaging 1.00
R8064:Adgrb3 UTSW 1 25420556 critical splice donor site probably null
R8161:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R8225:Adgrb3 UTSW 1 25826516 missense probably benign 0.00
R8417:Adgrb3 UTSW 1 25488053 missense probably benign 0.21
R8694:Adgrb3 UTSW 1 25826391 missense probably damaging 0.98
R8742:Adgrb3 UTSW 1 25226754 missense probably benign 0.01
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Z1176:Adgrb3 UTSW 1 25093914 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CTGTGAACCATCATAGGCAGC -3'
(R):5'- GTTTTCTTGCACATGCTATGTACTG -3'

Sequencing Primer
(F):5'- ATCATAGGCAGCACATTAAATCAG -3'
(R):5'- GCACATGCTATGTACTGTAGAAATAG -3'
Posted On2020-09-11