Incidental Mutation 'R8089:Cdh26'
ID 647936
Institutional Source Beutler Lab
Gene Symbol Cdh26
Ensembl Gene ENSMUSG00000039155
Gene Name cadherin-like 26
Synonyms LOC381409
MMRRC Submission 067522-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8089 (G1)
Quality Score 77.0075
Status Validated
Chromosome 2
Chromosomal Location 178072324-178129159 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 178099370 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042092] [ENSMUST00000108912]
AlphaFold P59862
Predicted Effect probably null
Transcript: ENSMUST00000042092
SMART Domains Protein: ENSMUSP00000048829
Gene: ENSMUSG00000039155

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108912
SMART Domains Protein: ENSMUSP00000104540
Gene: ENSMUSG00000039155

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.7%
Validation Efficiency 93% (54/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cadherin protein family. Cadherins are a family of calcium-dependent adhesion molecules that mediate cell-cell adhesion in all solid tissues and modulate a wide variety of processes, including cell polarization, migration and differentiation. Cadherin domains occur as repeats in the extracellular region and are thought to contribute to the sorting of heterogeneous cell types and the maintenance of orderly structures such as epithelium. This protein is expressed in gastrointestinal epithelial cells and may be upregulated during allergic inflammation. This protein interacts with alpha integrins and may also be involved in leukocyte migration and adhesion. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,104,383 (GRCm39) V768I probably benign Het
Abcc8 G A 7: 45,757,780 (GRCm39) T1323I probably benign Het
Adamtsl2 A G 2: 26,994,809 (GRCm39) M828V probably benign Het
Agmo A G 12: 37,397,306 (GRCm39) D153G probably benign Het
Akap13 T A 7: 75,260,340 (GRCm39) V185D possibly damaging Het
Asic1 A G 15: 99,595,968 (GRCm39) N414D probably damaging Het
Bin1 T A 18: 32,562,236 (GRCm39) probably null Het
Ccar1 C A 10: 62,626,770 (GRCm39) M1I probably null Het
Csmd3 C T 15: 47,532,603 (GRCm39) D1620N Het
Dennd4a A T 9: 64,756,457 (GRCm39) N204I probably damaging Het
Dgkb G A 12: 38,234,949 (GRCm39) S438N probably damaging Het
Dmxl1 T C 18: 50,021,897 (GRCm39) M1604T probably damaging Het
Fhad1 T A 4: 141,684,971 (GRCm39) D456V probably damaging Het
Gcfc2 C T 6: 81,902,771 (GRCm39) T86M probably damaging Het
Idua T A 5: 108,829,646 (GRCm39) M503K probably damaging Het
Ift70b T C 2: 75,767,647 (GRCm39) T369A possibly damaging Het
Ighm T C 12: 113,384,854 (GRCm39) probably benign Het
Kmt2d A T 15: 98,740,750 (GRCm39) S4676T unknown Het
Ldlrad1 G A 4: 107,066,688 (GRCm39) A8T probably benign Het
Lmtk2 G A 5: 144,093,718 (GRCm39) V232M probably benign Het
Map3k13 T C 16: 21,722,567 (GRCm39) V243A possibly damaging Het
Moxd1 A G 10: 24,157,417 (GRCm39) T350A probably benign Het
Nalcn A T 14: 123,537,372 (GRCm39) W1175R probably damaging Het
Or10u4 A T 10: 129,802,566 (GRCm39) M1K probably null Het
Or5h27 T G 16: 59,006,073 (GRCm39) I258L unknown Het
Or8g26 T A 9: 39,095,927 (GRCm39) V148E probably damaging Het
Pacsin2 A G 15: 83,263,897 (GRCm39) I380T probably benign Het
Plcd1 A C 9: 118,905,060 (GRCm39) C214G possibly damaging Het
Poglut3 C T 9: 53,307,262 (GRCm39) A402V probably benign Het
Ptprm C A 17: 66,990,483 (GRCm39) W1385L possibly damaging Het
Rab22a C T 2: 173,530,013 (GRCm39) Q64* probably null Het
Rasa2 G T 9: 96,435,177 (GRCm39) H604Q probably benign Het
Rasal1 G A 5: 120,809,643 (GRCm39) G516D probably damaging Het
Rasgrp3 A T 17: 75,804,056 (GRCm39) I120L possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rgs12 T C 5: 35,177,692 (GRCm39) I742T probably damaging Het
Scyl3 A G 1: 163,763,996 (GRCm39) T121A possibly damaging Het
Six5 T G 7: 18,828,797 (GRCm39) F79C probably damaging Het
Tbx3 G A 5: 119,818,634 (GRCm39) R423H probably damaging Het
Terf2ip C T 8: 112,738,424 (GRCm39) T104M probably benign Het
Tmem135 A G 7: 88,805,703 (GRCm39) C234R probably damaging Het
Tnxb C G 17: 34,891,763 (GRCm39) A702G unknown Het
Tspan1 T C 4: 116,021,532 (GRCm39) K83R probably null Het
Ttn C T 2: 76,728,406 (GRCm39) probably null Het
Usp5 A T 6: 124,797,373 (GRCm39) probably null Het
Vmn1r27 T A 6: 58,192,194 (GRCm39) Y270F possibly damaging Het
Vmn2r110 G A 17: 20,803,807 (GRCm39) T256I probably benign Het
Zfp831 T A 2: 174,486,717 (GRCm39) L464Q possibly damaging Het
Zscan4-ps3 C A 7: 11,346,659 (GRCm39) H232N probably benign Het
Other mutations in Cdh26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cdh26 APN 2 178,123,417 (GRCm39) missense possibly damaging 0.86
IGL01341:Cdh26 APN 2 178,099,240 (GRCm39) missense probably damaging 0.99
IGL02636:Cdh26 APN 2 178,091,755 (GRCm39) missense probably damaging 1.00
IGL03144:Cdh26 APN 2 178,109,967 (GRCm39) missense probably damaging 0.99
R0244:Cdh26 UTSW 2 178,123,425 (GRCm39) missense possibly damaging 0.88
R0245:Cdh26 UTSW 2 178,123,425 (GRCm39) missense possibly damaging 0.88
R0466:Cdh26 UTSW 2 178,123,425 (GRCm39) missense possibly damaging 0.88
R0467:Cdh26 UTSW 2 178,123,425 (GRCm39) missense possibly damaging 0.88
R0514:Cdh26 UTSW 2 178,108,621 (GRCm39) critical splice donor site probably null
R0610:Cdh26 UTSW 2 178,091,691 (GRCm39) missense probably damaging 1.00
R0733:Cdh26 UTSW 2 178,128,724 (GRCm39) missense probably damaging 1.00
R1592:Cdh26 UTSW 2 178,091,684 (GRCm39) missense probably damaging 1.00
R2483:Cdh26 UTSW 2 178,108,382 (GRCm39) missense probably damaging 1.00
R3756:Cdh26 UTSW 2 178,111,794 (GRCm39) splice site probably benign
R4617:Cdh26 UTSW 2 178,102,435 (GRCm39) intron probably benign
R4914:Cdh26 UTSW 2 178,091,614 (GRCm39) missense probably benign 0.02
R4915:Cdh26 UTSW 2 178,091,614 (GRCm39) missense probably benign 0.02
R4917:Cdh26 UTSW 2 178,091,614 (GRCm39) missense probably benign 0.02
R4918:Cdh26 UTSW 2 178,091,614 (GRCm39) missense probably benign 0.02
R5086:Cdh26 UTSW 2 178,083,210 (GRCm39) nonsense probably null
R5573:Cdh26 UTSW 2 178,108,482 (GRCm39) missense probably damaging 0.96
R5809:Cdh26 UTSW 2 178,101,919 (GRCm39) nonsense probably null
R5941:Cdh26 UTSW 2 178,123,443 (GRCm39) nonsense probably null
R6284:Cdh26 UTSW 2 178,091,677 (GRCm39) missense probably damaging 1.00
R6341:Cdh26 UTSW 2 178,113,366 (GRCm39) splice site probably null
R6496:Cdh26 UTSW 2 178,091,654 (GRCm39) missense probably damaging 1.00
R7132:Cdh26 UTSW 2 178,128,555 (GRCm39) missense possibly damaging 0.56
R7664:Cdh26 UTSW 2 178,111,835 (GRCm39) missense probably benign 0.02
R7694:Cdh26 UTSW 2 178,101,896 (GRCm39) missense probably damaging 0.96
R7814:Cdh26 UTSW 2 178,111,828 (GRCm39) missense probably damaging 0.98
R8103:Cdh26 UTSW 2 178,110,006 (GRCm39) missense probably damaging 1.00
R8412:Cdh26 UTSW 2 178,104,517 (GRCm39) missense probably damaging 0.98
R8413:Cdh26 UTSW 2 178,110,022 (GRCm39) missense probably damaging 0.99
R9025:Cdh26 UTSW 2 178,104,409 (GRCm39) missense probably benign 0.01
R9621:Cdh26 UTSW 2 178,111,983 (GRCm39) missense probably damaging 1.00
R9628:Cdh26 UTSW 2 178,083,213 (GRCm39) missense
RF002:Cdh26 UTSW 2 178,108,424 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGTAACTCCTTCGCCAGGG -3'
(R):5'- GCAGAGCGAAGACTTCTGTG -3'

Sequencing Primer
(F):5'- GGTCTTCAGGTAGACACAGC -3'
(R):5'- TGGTTCTGGGCCTGCAAC -3'
Posted On 2020-09-14