Incidental Mutation 'R7914:Sae1'
ID 647958
Institutional Source Beutler Lab
Gene Symbol Sae1
Ensembl Gene ENSMUSG00000052833
Gene Name SUMO1 activating enzyme subunit 1
Synonyms HSPC140, D7Ertd177e, Uble1a, 2610044L12Rik, AOS1, 2400010M20Rik, SUMO-1 activating enzyme subunit 1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R7914 (G1)
Quality Score 121.008
Status Validated
Chromosome 7
Chromosomal Location 16320234-16387806 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 16387723 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 10 (G10C)
Ref Sequence ENSEMBL: ENSMUSP00000092409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094815] [ENSMUST00000210999] [ENSMUST00000211741]
AlphaFold Q9R1T2
Predicted Effect unknown
Transcript: ENSMUST00000094815
AA Change: G10C
SMART Domains Protein: ENSMUSP00000092409
Gene: ENSMUSG00000052833
AA Change: G10C

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:ThiF 23 344 4.3e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000210999
AA Change: G10C
Predicted Effect unknown
Transcript: ENSMUST00000211741
AA Change: G10C
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G T 10: 100,592,676 V12F probably benign Het
4932438A13Rik A T 3: 36,946,283 N1204Y probably benign Het
Adnp2 T A 18: 80,130,841 R118W probably damaging Het
Apaf1 G A 10: 91,060,233 R337C probably damaging Het
Arhgef40 T C 14: 51,987,575 L59P probably damaging Het
B020011L13Rik A G 1: 117,801,432 E223G probably benign Het
Bcl6 T C 16: 23,970,011 R536G possibly damaging Het
Catsperg1 T C 7: 29,195,426 E582G probably benign Het
Ccdc136 A G 6: 29,419,307 N942S probably damaging Het
Ccdc81 A C 7: 89,875,780 M531R possibly damaging Het
Cep78 T C 19: 15,976,308 E283G probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
E230025N22Rik C A 18: 36,695,552 R24S possibly damaging Het
Epb41l1 T A 2: 156,522,208 M879K probably benign Het
Fam135a T C 1: 24,026,679 Y1226C probably damaging Het
Fam212a T C 9: 107,985,562 probably benign Het
Fbxo11 T C 17: 88,012,603 E151G Het
Herc6 A G 6: 57,607,121 T322A probably benign Het
Kalrn T A 16: 34,028,752 Q2110L probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc19 T A 4: 94,638,300 H340L probably damaging Het
Mkks A T 2: 136,880,956 F94I probably damaging Het
Pcdhga3 T A 18: 37,674,960 F155L probably benign Het
Pdlim1 T A 19: 40,252,001 I53F probably damaging Het
Pttg1 A T 11: 43,425,594 L26Q probably benign Het
Rasa4 T A 5: 136,101,656 probably benign Het
Rsbn1l A G 5: 20,905,898 S481P probably damaging Het
Samd15 T C 12: 87,201,785 S415P probably damaging Het
Scn7a T A 2: 66,699,950 I684F probably damaging Het
Sec23b T A 2: 144,564,645 M120K probably benign Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Slf2 T A 19: 44,959,060 M821K possibly damaging Het
Suv39h2 G A 2: 3,464,416 R301* probably null Het
Tgfbi A G 13: 56,629,689 T329A probably damaging Het
Tmprss12 T C 15: 100,285,230 F151S probably damaging Het
Ttn T C 2: 76,917,181 D4508G probably benign Het
Tyk2 C A 9: 21,121,555 C304F probably benign Het
Vmn1r121 T A 7: 21,097,664 T284S probably benign Het
Vmn2r117 A G 17: 23,460,126 I708T possibly damaging Het
Vmn2r2 A T 3: 64,134,105 D396E probably benign Het
Zfc3h1 A G 10: 115,403,157 probably null Het
Zic4 T G 9: 91,384,128 V275G probably damaging Het
Other mutations in Sae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Sae1 APN 7 16330656 missense possibly damaging 0.94
IGL02672:Sae1 APN 7 16370348 missense probably damaging 1.00
IGL02881:Sae1 APN 7 16359118 missense probably damaging 1.00
R0255:Sae1 UTSW 7 16370322 nonsense probably null
R0667:Sae1 UTSW 7 16368532 missense probably damaging 1.00
R1374:Sae1 UTSW 7 16378408 missense probably damaging 0.97
R1585:Sae1 UTSW 7 16330612 critical splice donor site probably null
R1960:Sae1 UTSW 7 16368565 missense possibly damaging 0.90
R2278:Sae1 UTSW 7 16370366 missense probably damaging 1.00
R5513:Sae1 UTSW 7 16366856 missense probably benign 0.00
R5677:Sae1 UTSW 7 16370462 critical splice acceptor site probably null
R6694:Sae1 UTSW 7 16368536 missense probably damaging 1.00
R6975:Sae1 UTSW 7 16336787 missense probably damaging 0.99
R7307:Sae1 UTSW 7 16368544 nonsense probably null
R8437:Sae1 UTSW 7 16370354 missense probably damaging 1.00
R9076:Sae1 UTSW 7 16336743 missense probably benign
Z1177:Sae1 UTSW 7 16327871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACACCGTCCATTCGTCAG -3'
(R):5'- CTTGGAGTCTTCGGTATCCAC -3'

Sequencing Primer
(F):5'- CATTCGTCAGTTCTGAAGCACTAGG -3'
(R):5'- AGTCTTCGGTATCCACGTGGTC -3'
Posted On 2020-09-15