Incidental Mutation 'R7914:1700017N19Rik'
ID647968
Institutional Source Beutler Lab
Gene Symbol 1700017N19Rik
Ensembl Gene ENSMUSG00000056912
Gene NameRIKEN cDNA 1700017N19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7914 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location100590484-100618401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100592676 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 12 (V12F)
Ref Sequence ENSEMBL: ENSMUSP00000139797 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000041162
Predicted Effect probably benign
Transcript: ENSMUST00000054471
Predicted Effect probably benign
Transcript: ENSMUST00000186825
AA Change: V12F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000187119
Predicted Effect probably benign
Transcript: ENSMUST00000188736
Predicted Effect probably benign
Transcript: ENSMUST00000188930
Predicted Effect probably benign
Transcript: ENSMUST00000190386
Predicted Effect probably benign
Transcript: ENSMUST00000190708
AA Change: V12F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000191336
Predicted Effect probably benign
Transcript: ENSMUST00000218328
Predicted Effect probably benign
Transcript: ENSMUST00000218464
Predicted Effect probably benign
Transcript: ENSMUST00000218821
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,946,283 N1204Y probably benign Het
Adnp2 T A 18: 80,130,841 R118W probably damaging Het
Apaf1 G A 10: 91,060,233 R337C probably damaging Het
Arhgef40 T C 14: 51,987,575 L59P probably damaging Het
B020011L13Rik A G 1: 117,801,432 E223G probably benign Het
Bcl6 T C 16: 23,970,011 R536G possibly damaging Het
Catsperg1 T C 7: 29,195,426 E582G probably benign Het
Ccdc136 A G 6: 29,419,307 N942S probably damaging Het
Ccdc81 A C 7: 89,875,780 M531R possibly damaging Het
Cep78 T C 19: 15,976,308 E283G probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
E230025N22Rik C A 18: 36,695,552 R24S possibly damaging Het
Epb41l1 T A 2: 156,522,208 M879K probably benign Het
Fam135a T C 1: 24,026,679 Y1226C probably damaging Het
Fam212a T C 9: 107,985,562 probably benign Het
Fbxo11 T C 17: 88,012,603 E151G Het
Herc6 A G 6: 57,607,121 T322A probably benign Het
Kalrn T A 16: 34,028,752 Q2110L probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc19 T A 4: 94,638,300 H340L probably damaging Het
Mkks A T 2: 136,880,956 F94I probably damaging Het
Pcdhga3 T A 18: 37,674,960 F155L probably benign Het
Pdlim1 T A 19: 40,252,001 I53F probably damaging Het
Pttg1 A T 11: 43,425,594 L26Q probably benign Het
Rasa4 T A 5: 136,101,656 probably benign Het
Rsbn1l A G 5: 20,905,898 S481P probably damaging Het
Sae1 C A 7: 16,387,723 G10C unknown Het
Samd15 T C 12: 87,201,785 S415P probably damaging Het
Scn7a T A 2: 66,699,950 I684F probably damaging Het
Sec23b T A 2: 144,564,645 M120K probably benign Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Slf2 T A 19: 44,959,060 M821K possibly damaging Het
Suv39h2 G A 2: 3,464,416 R301* probably null Het
Tgfbi A G 13: 56,629,689 T329A probably damaging Het
Tmprss12 T C 15: 100,285,230 F151S probably damaging Het
Ttn T C 2: 76,917,181 D4508G probably benign Het
Tyk2 C A 9: 21,121,555 C304F probably benign Het
Vmn1r121 T A 7: 21,097,664 T284S probably benign Het
Vmn2r117 A G 17: 23,460,126 I708T possibly damaging Het
Vmn2r2 A T 3: 64,134,105 D396E probably benign Het
Zfc3h1 A G 10: 115,403,157 probably null Het
Zic4 T G 9: 91,384,128 V275G probably damaging Het
Other mutations in 1700017N19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:1700017N19Rik APN 10 100603360 missense probably damaging 1.00
IGL02159:1700017N19Rik APN 10 100610665 missense probably damaging 1.00
IGL02556:1700017N19Rik APN 10 100610717 critical splice donor site probably null
IGL02629:1700017N19Rik APN 10 100609144 splice site probably benign
IGL02692:1700017N19Rik APN 10 100603548 missense probably benign 0.05
IGL02962:1700017N19Rik APN 10 100610593 splice site probably null
R0145:1700017N19Rik UTSW 10 100601921 missense probably damaging 0.96
R0402:1700017N19Rik UTSW 10 100609253 missense probably damaging 0.99
R1514:1700017N19Rik UTSW 10 100612867 missense probably damaging 1.00
R1519:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1680:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1686:1700017N19Rik UTSW 10 100612860 missense probably damaging 0.97
R3951:1700017N19Rik UTSW 10 100615296 splice site probably benign
R3952:1700017N19Rik UTSW 10 100615296 splice site probably benign
R4423:1700017N19Rik UTSW 10 100605633 missense probably damaging 0.99
R4905:1700017N19Rik UTSW 10 100612818 splice site probably null
R5507:1700017N19Rik UTSW 10 100609233 missense probably benign 0.02
R5898:1700017N19Rik UTSW 10 100612900 missense possibly damaging 0.56
R5898:1700017N19Rik UTSW 10 100615208 missense probably benign 0.20
R5977:1700017N19Rik UTSW 10 100615244 missense probably damaging 0.99
R7034:1700017N19Rik UTSW 10 100609256 critical splice donor site probably null
R7036:1700017N19Rik UTSW 10 100609256 critical splice donor site probably null
R7394:1700017N19Rik UTSW 10 100609176 missense probably benign 0.01
R7412:1700017N19Rik UTSW 10 100612829 nonsense probably null
R7870:1700017N19Rik UTSW 10 100605643 missense probably benign
Z1088:1700017N19Rik UTSW 10 100605639 missense probably damaging 1.00
Z1176:1700017N19Rik UTSW 10 100612429 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGAATACTACTGATAGCCTCAAAG -3'
(R):5'- CACGGTGGATAGTAACCTGAATTC -3'

Sequencing Primer
(F):5'- GGCTGTGGAAAAGAACAAGTTTTC -3'
(R):5'- TGTATGACTGAAATACATTCACCAAC -3'
Posted On2020-09-15