Incidental Mutation 'R7914:Adnp2'
ID647980
Institutional Source Beutler Lab
Gene Symbol Adnp2
Ensembl Gene ENSMUSG00000053950
Gene NameADNP homeobox 2
SynonymsZfp508, 8430420L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7914 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location80126311-80151482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80130841 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 118 (R118W)
Ref Sequence ENSEMBL: ENSMUSP00000068560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066743]
Predicted Effect probably damaging
Transcript: ENSMUST00000066743
AA Change: R118W

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068560
Gene: ENSMUSG00000053950
AA Change: R118W

DomainStartEndE-ValueType
ZnF_C2H2 73 96 4.57e0 SMART
ZnF_C2H2 106 128 1.06e2 SMART
ZnF_C2H2 155 178 5.48e0 SMART
ZnF_C2H2 215 240 7.29e0 SMART
low complexity region 277 290 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 333 355 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 625 648 N/A INTRINSIC
low complexity region 656 674 N/A INTRINSIC
ZnF_C2H2 696 718 9.96e0 SMART
ZnF_C2H2 724 746 4.99e1 SMART
low complexity region 747 761 N/A INTRINSIC
ZnF_C2H2 777 798 1.93e2 SMART
ZnF_C2H2 800 823 4.34e0 SMART
ZnF_C2H2 905 928 5.81e-2 SMART
HOX 1073 1135 3.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G T 10: 100,592,676 V12F probably benign Het
4932438A13Rik A T 3: 36,946,283 N1204Y probably benign Het
Apaf1 G A 10: 91,060,233 R337C probably damaging Het
Arhgef40 T C 14: 51,987,575 L59P probably damaging Het
B020011L13Rik A G 1: 117,801,432 E223G probably benign Het
Bcl6 T C 16: 23,970,011 R536G possibly damaging Het
Catsperg1 T C 7: 29,195,426 E582G probably benign Het
Ccdc136 A G 6: 29,419,307 N942S probably damaging Het
Ccdc81 A C 7: 89,875,780 M531R possibly damaging Het
Cep78 T C 19: 15,976,308 E283G probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
E230025N22Rik C A 18: 36,695,552 R24S possibly damaging Het
Epb41l1 T A 2: 156,522,208 M879K probably benign Het
Fam135a T C 1: 24,026,679 Y1226C probably damaging Het
Fam212a T C 9: 107,985,562 probably benign Het
Fbxo11 T C 17: 88,012,603 E151G Het
Herc6 A G 6: 57,607,121 T322A probably benign Het
Kalrn T A 16: 34,028,752 Q2110L probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc19 T A 4: 94,638,300 H340L probably damaging Het
Mkks A T 2: 136,880,956 F94I probably damaging Het
Pcdhga3 T A 18: 37,674,960 F155L probably benign Het
Pdlim1 T A 19: 40,252,001 I53F probably damaging Het
Pknox2 GACTACT GACT 9: 36,892,823 probably null Het
Pttg1 A T 11: 43,425,594 L26Q probably benign Het
Rsbn1l A G 5: 20,905,898 S481P probably damaging Het
Sae1 C A 7: 16,387,723 G10C unknown Het
Samd15 T C 12: 87,201,785 S415P probably damaging Het
Scn7a T A 2: 66,699,950 I684F probably damaging Het
Sec23b T A 2: 144,564,645 M120K probably benign Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Slf2 T A 19: 44,959,060 M821K possibly damaging Het
Suv39h2 G A 2: 3,464,416 R301* probably null Het
Tgfbi A G 13: 56,629,689 T329A probably damaging Het
Tmprss12 T C 15: 100,285,230 F151S probably damaging Het
Ttn T C 2: 76,917,181 D4508G probably benign Het
Tyk2 C A 9: 21,121,555 C304F probably benign Het
Vmn1r121 T A 7: 21,097,664 T284S probably benign Het
Vmn2r117 A G 17: 23,460,126 I708T possibly damaging Het
Vmn2r2 A T 3: 64,134,105 D396E probably benign Het
Zic4 T G 9: 91,384,128 V275G probably damaging Het
Other mutations in Adnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Adnp2 APN 18 80128867 missense probably benign 0.00
IGL00730:Adnp2 APN 18 80128032 missense probably benign
IGL01615:Adnp2 APN 18 80128477 missense probably damaging 1.00
IGL01681:Adnp2 APN 18 80127888 missense probably damaging 1.00
IGL02549:Adnp2 APN 18 80129118 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0325:Adnp2 UTSW 18 80130653 missense probably benign 0.06
R0478:Adnp2 UTSW 18 80129334 missense probably benign 0.31
R0545:Adnp2 UTSW 18 80129401 missense probably benign 0.31
R0788:Adnp2 UTSW 18 80130004 missense probably benign
R1756:Adnp2 UTSW 18 80127697 makesense probably null
R2043:Adnp2 UTSW 18 80128326 missense probably damaging 1.00
R2121:Adnp2 UTSW 18 80129170 missense probably benign 0.00
R2260:Adnp2 UTSW 18 80128449 missense probably benign 0.01
R2374:Adnp2 UTSW 18 80130987 missense probably damaging 1.00
R3416:Adnp2 UTSW 18 80128158 missense possibly damaging 0.55
R3607:Adnp2 UTSW 18 80129069 missense probably damaging 1.00
R4012:Adnp2 UTSW 18 80130821 missense probably benign 0.01
R4260:Adnp2 UTSW 18 80137527 missense possibly damaging 0.85
R4588:Adnp2 UTSW 18 80128648 missense probably benign 0.22
R5158:Adnp2 UTSW 18 80137543 missense probably damaging 0.99
R5652:Adnp2 UTSW 18 80130850 missense probably damaging 1.00
R5717:Adnp2 UTSW 18 80128264 missense probably benign 0.13
R6743:Adnp2 UTSW 18 80128059 missense probably benign 0.00
R6786:Adnp2 UTSW 18 80129745 missense probably benign 0.03
R6903:Adnp2 UTSW 18 80130090 missense probably benign
R7105:Adnp2 UTSW 18 80128151 missense possibly damaging 0.94
R7507:Adnp2 UTSW 18 80130853 missense probably benign 0.22
R7620:Adnp2 UTSW 18 80130487 missense probably damaging 1.00
R7991:Adnp2 UTSW 18 80129322 missense probably damaging 0.97
R8290:Adnp2 UTSW 18 80142733 missense probably damaging 1.00
R8366:Adnp2 UTSW 18 80130510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGTGCTTCTTCATGCTGTAG -3'
(R):5'- GGATCTTGGCAGTGAAGCAC -3'

Sequencing Primer
(F):5'- GTACAGAGTGTTGGAAAAGTTACAC -3'
(R):5'- GGTGACTTGTTCCTCTGTCTAAGAC -3'
Posted On2020-09-15