Incidental Mutation 'R7915:Hivep3'
ID 648000
Institutional Source Beutler Lab
Gene Symbol Hivep3
Ensembl Gene ENSMUSG00000028634
Gene Name human immunodeficiency virus type I enhancer binding protein 3
Synonyms E030045D18Rik, Schnurri-3, Shn3, 2900056N03Rik, Krc
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7915 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 119733784-120138045 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120097765 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1093 (S1093T)
Ref Sequence ENSEMBL: ENSMUSP00000101914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106307] [ENSMUST00000166542] [ENSMUST00000226560]
AlphaFold A2A884
Predicted Effect possibly damaging
Transcript: ENSMUST00000106307
AA Change: S1093T

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101914
Gene: ENSMUSG00000028634
AA Change: S1093T

DomainStartEndE-ValueType
ZnF_C2H2 185 207 1.67e-2 SMART
ZnF_C2H2 213 235 8.34e-3 SMART
low complexity region 257 285 N/A INTRINSIC
low complexity region 292 323 N/A INTRINSIC
low complexity region 425 438 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
low complexity region 589 612 N/A INTRINSIC
low complexity region 622 633 N/A INTRINSIC
ZnF_C2H2 636 656 2.06e1 SMART
low complexity region 736 749 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 844 865 N/A INTRINSIC
low complexity region 878 894 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1110 1136 N/A INTRINSIC
low complexity region 1143 1167 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1259 1284 N/A INTRINSIC
low complexity region 1376 1390 N/A INTRINSIC
low complexity region 1529 1547 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
ZnF_C2H2 1720 1742 1.82e-3 SMART
ZnF_C2H2 1748 1772 1.69e-3 SMART
low complexity region 1778 1791 N/A INTRINSIC
low complexity region 1814 1843 N/A INTRINSIC
low complexity region 2203 2216 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166542
AA Change: S1093T

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130249
Gene: ENSMUSG00000028634
AA Change: S1093T

DomainStartEndE-ValueType
ZnF_C2H2 185 207 1.67e-2 SMART
ZnF_C2H2 213 235 8.34e-3 SMART
low complexity region 257 285 N/A INTRINSIC
low complexity region 292 323 N/A INTRINSIC
low complexity region 425 438 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
low complexity region 589 612 N/A INTRINSIC
low complexity region 622 633 N/A INTRINSIC
ZnF_C2H2 636 656 2.06e1 SMART
low complexity region 736 749 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 844 865 N/A INTRINSIC
low complexity region 878 894 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1110 1136 N/A INTRINSIC
low complexity region 1143 1167 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1259 1284 N/A INTRINSIC
low complexity region 1376 1390 N/A INTRINSIC
low complexity region 1529 1547 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
ZnF_C2H2 1720 1742 1.82e-3 SMART
ZnF_C2H2 1748 1772 1.69e-3 SMART
low complexity region 1778 1791 N/A INTRINSIC
low complexity region 1814 1843 N/A INTRINSIC
low complexity region 2203 2216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226560
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the human immunodeficiency virus type 1 enhancer-binding protein family. Members of this protein family contain multiple zinc finger and acid-rich (ZAS) domains and serine-threonine rich regions. This protein acts as a transcription factor and is able to regulate nuclear factor kappaB-mediated transcription by binding the kappaB motif in target genes. This protein also binds the recombination signal sequence that flanks the V, D, and J regions of immunoglobulin and T-cell receptors. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in diminished IL-2 production by stimulated CD4 cells. Mice homozygous for a knock-out allele exhibit increased bone volume. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T C 8: 11,678,645 T9A possibly damaging Het
Abca17 T G 17: 24,265,533 H1585P probably damaging Het
Acaca A T 11: 84,276,588 T1063S probably benign Het
Actc1 T A 2: 114,050,486 K86M probably damaging Het
Amz1 A G 5: 140,741,435 N51S probably benign Het
Arhgap33 G A 7: 30,523,223 P1095S probably benign Het
Bicra T C 7: 15,988,522 T357A probably benign Het
C130032M10Rik A G 9: 114,516,055 R120G unknown Het
Cadps A G 14: 12,705,544 F284L possibly damaging Het
Ccdc83 G A 7: 90,244,082 Q156* probably null Het
Cdh20 T A 1: 104,934,173 M26K probably benign Het
Cdh23 A G 10: 60,307,889 L2979P probably damaging Het
Crocc2 T C 1: 93,213,641 L1172P probably damaging Het
Cyp2d10 C T 15: 82,404,427 probably null Het
Cyp2j9 T A 4: 96,591,384 probably benign Het
Dgcr2 A G 16: 17,859,402 probably null Het
Dio3 A G 12: 110,280,039 M270V Het
Dll1 C A 17: 15,368,428 D662Y probably damaging Het
Drd1 G T 13: 54,053,815 P127T probably damaging Het
Evc2 T C 5: 37,386,862 S652P probably damaging Het
Fam149a C A 8: 45,341,243 M708I probably benign Het
Fam89a T C 8: 124,741,156 E139G probably damaging Het
Gm13088 T C 4: 143,655,745 K127R possibly damaging Het
Gm28710 A G 5: 16,827,014 N556D probably benign Het
Gpr141 T C 13: 19,752,559 I15M probably benign Het
Hcn4 G A 9: 58,823,935 E142K unknown Het
Inpp5f C A 7: 128,667,709 T261K probably benign Het
Ints3 A T 3: 90,432,825 D42E probably benign Het
Krt90 A T 15: 101,558,403 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrig1 C A 6: 94,630,101 probably null Het
Mapk14 A G 17: 28,728,954 T221A probably benign Het
Megf10 A T 18: 57,240,735 T202S probably benign Het
Neo1 A T 9: 58,930,981 F507I probably benign Het
Olfr1084 T A 2: 86,638,766 *314L probably null Het
Olfr1351 A G 10: 79,017,430 Y36C probably damaging Het
Olfr912 A T 9: 38,581,673 Y132F probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pkd1 T A 17: 24,592,656 Y3724* probably null Het
Plxnd1 T C 6: 115,966,918 D1140G probably benign Het
Prex1 A G 2: 166,621,192 S250P probably damaging Het
Prom1 A T 5: 44,004,935 M777K possibly damaging Het
Prrc2c A C 1: 162,692,408 S2125A probably benign Het
Ptpn12 A G 5: 21,009,451 I229T probably damaging Het
Ranbp6 A G 19: 29,812,673 V93A probably benign Het
Rtn3 A G 19: 7,457,500 C376R probably benign Het
Sis A C 3: 72,921,138 H1201Q probably damaging Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Slc3a2 G A 19: 8,707,818 R535W probably damaging Het
Slc5a2 T A 7: 128,265,794 L33Q probably damaging Het
Sltm G T 9: 70,587,149 R927L probably damaging Het
Stat1 A G 1: 52,151,281 D565G probably benign Het
Terb1 T C 8: 104,447,216 K745R possibly damaging Het
Tescl T C 7: 24,333,688 I71V probably damaging Het
Tgm1 T C 14: 55,700,426 D742G probably damaging Het
Tmem128 T A 5: 38,266,531 W30R probably benign Het
Tox T A 4: 6,822,949 M123L probably benign Het
Tsnaxip1 A G 8: 105,842,781 S547G possibly damaging Het
Ttn T A 2: 76,737,195 K27785* probably null Het
Usp38 A C 8: 81,001,083 S340R probably damaging Het
Utrn A T 10: 12,465,212 H2840Q probably damaging Het
Vars2 T C 17: 35,664,839 I229V probably damaging Het
Vmn1r16 A T 6: 57,323,395 Y81N probably damaging Het
Vmn2r98 A T 17: 19,067,231 D442V probably benign Het
Vps13d T C 4: 145,086,819 I3296V Het
Wwtr1 A G 3: 57,575,599 probably null Het
Zcchc6 T C 13: 59,784,814 I1345V probably benign Het
Other mutations in Hivep3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Hivep3 APN 4 120098374 missense probably damaging 1.00
IGL01017:Hivep3 APN 4 120099246 missense probably damaging 0.98
IGL01837:Hivep3 APN 4 120094562 missense possibly damaging 0.72
IGL01878:Hivep3 APN 4 120095227 missense possibly damaging 0.84
IGL02134:Hivep3 APN 4 120133574 splice site probably benign
IGL02183:Hivep3 APN 4 120132024 missense probably benign 0.04
IGL02350:Hivep3 APN 4 120123025 missense probably damaging 1.00
IGL02451:Hivep3 APN 4 120133965 missense probably damaging 1.00
IGL02567:Hivep3 APN 4 120133956 missense probably damaging 0.99
IGL02617:Hivep3 APN 4 120095444 missense probably benign 0.04
IGL02725:Hivep3 APN 4 120095822 missense possibly damaging 0.48
IGL02828:Hivep3 APN 4 120097732 nonsense probably null
IGL02954:Hivep3 APN 4 120133641 missense probably damaging 1.00
IGL02966:Hivep3 APN 4 120132186 missense probably benign 0.04
Branchial UTSW 4 120096575 missense possibly damaging 0.92
Deceit UTSW 4 120097911 frame shift probably null
Mandible UTSW 4 120097121 missense probably damaging 0.99
Sclerotic UTSW 4 120095099 missense possibly damaging 0.82
Stealth UTSW 4 120122876 nonsense probably null
Yellowjacket UTSW 4 120132357 missense probably benign 0.01
PIT4260001:Hivep3 UTSW 4 120099182 missense probably damaging 1.00
R0321:Hivep3 UTSW 4 120095591 missense possibly damaging 0.84
R0336:Hivep3 UTSW 4 120103847 missense probably damaging 1.00
R0558:Hivep3 UTSW 4 120096566 missense probably damaging 0.98
R0562:Hivep3 UTSW 4 120096554 missense probably benign 0.00
R0637:Hivep3 UTSW 4 120132541 nonsense probably null
R0645:Hivep3 UTSW 4 120097334 missense possibly damaging 0.95
R1186:Hivep3 UTSW 4 119814723 start gained probably benign
R1254:Hivep3 UTSW 4 120099293 missense probably damaging 1.00
R1428:Hivep3 UTSW 4 120096575 missense possibly damaging 0.92
R1623:Hivep3 UTSW 4 120095704 missense possibly damaging 0.84
R1739:Hivep3 UTSW 4 120095174 missense probably benign 0.03
R1766:Hivep3 UTSW 4 120096671 missense probably benign
R1769:Hivep3 UTSW 4 120097571 missense possibly damaging 0.68
R1773:Hivep3 UTSW 4 120098837 missense probably damaging 1.00
R1968:Hivep3 UTSW 4 120096238 missense possibly damaging 0.83
R2220:Hivep3 UTSW 4 119734038 missense possibly damaging 0.92
R2428:Hivep3 UTSW 4 120098508 nonsense probably null
R3789:Hivep3 UTSW 4 120098416 missense probably damaging 1.00
R3917:Hivep3 UTSW 4 120099427 missense probably benign 0.27
R4366:Hivep3 UTSW 4 120096089 missense possibly damaging 0.84
R4436:Hivep3 UTSW 4 120095923 missense probably benign 0.11
R4504:Hivep3 UTSW 4 119733793 unclassified probably benign
R4705:Hivep3 UTSW 4 119872050 intron probably benign
R4713:Hivep3 UTSW 4 120131803 missense probably damaging 1.00
R4756:Hivep3 UTSW 4 120097823 missense probably damaging 0.98
R4887:Hivep3 UTSW 4 120122934 missense probably damaging 1.00
R4888:Hivep3 UTSW 4 120122934 missense probably damaging 1.00
R5008:Hivep3 UTSW 4 120098917 missense probably benign 0.22
R5204:Hivep3 UTSW 4 120103856 critical splice donor site probably null
R5594:Hivep3 UTSW 4 120123048 critical splice donor site probably null
R5697:Hivep3 UTSW 4 120096955 missense possibly damaging 0.68
R5715:Hivep3 UTSW 4 120096373 missense probably benign
R5740:Hivep3 UTSW 4 120096023 missense possibly damaging 0.83
R5760:Hivep3 UTSW 4 120095011 missense possibly damaging 0.83
R5923:Hivep3 UTSW 4 120096293 missense possibly damaging 0.92
R5927:Hivep3 UTSW 4 120097108 missense possibly damaging 0.68
R6042:Hivep3 UTSW 4 120097864 missense possibly damaging 0.85
R6074:Hivep3 UTSW 4 120097694 missense possibly damaging 0.68
R6150:Hivep3 UTSW 4 119734077 nonsense probably null
R6211:Hivep3 UTSW 4 120098405 missense probably damaging 1.00
R6251:Hivep3 UTSW 4 120094940 missense probably damaging 0.98
R6451:Hivep3 UTSW 4 120098908 missense probably benign 0.22
R6531:Hivep3 UTSW 4 120122876 nonsense probably null
R6651:Hivep3 UTSW 4 120122949 missense probably damaging 1.00
R6701:Hivep3 UTSW 4 120094540 missense probably damaging 0.97
R6721:Hivep3 UTSW 4 120095099 missense possibly damaging 0.82
R6796:Hivep3 UTSW 4 120096361 missense possibly damaging 0.68
R6864:Hivep3 UTSW 4 120094888 missense possibly damaging 0.48
R6902:Hivep3 UTSW 4 120095995 missense possibly damaging 0.48
R7111:Hivep3 UTSW 4 120095234 missense possibly damaging 0.68
R7113:Hivep3 UTSW 4 120098369 missense probably damaging 1.00
R7140:Hivep3 UTSW 4 120097121 missense probably damaging 0.99
R7189:Hivep3 UTSW 4 120132219 missense probably damaging 0.99
R7218:Hivep3 UTSW 4 120095452 missense possibly damaging 0.92
R7366:Hivep3 UTSW 4 120097911 frame shift probably null
R7368:Hivep3 UTSW 4 120097911 frame shift probably null
R7491:Hivep3 UTSW 4 120098830 missense probably benign 0.09
R7496:Hivep3 UTSW 4 120132402 missense probably benign 0.00
R7514:Hivep3 UTSW 4 120096855 missense possibly damaging 0.48
R7604:Hivep3 UTSW 4 120097911 frame shift probably null
R7605:Hivep3 UTSW 4 120097911 frame shift probably null
R7607:Hivep3 UTSW 4 120097911 frame shift probably null
R7610:Hivep3 UTSW 4 120097911 frame shift probably null
R7611:Hivep3 UTSW 4 120097911 frame shift probably null
R7613:Hivep3 UTSW 4 120097911 frame shift probably null
R7626:Hivep3 UTSW 4 120097911 frame shift probably null
R7707:Hivep3 UTSW 4 119733959 missense
R7736:Hivep3 UTSW 4 120095543 missense possibly damaging 0.92
R7943:Hivep3 UTSW 4 120132357 missense probably benign 0.01
R7972:Hivep3 UTSW 4 120097514 missense possibly damaging 0.48
R8093:Hivep3 UTSW 4 120095435 missense possibly damaging 0.68
R8111:Hivep3 UTSW 4 120098386 missense probably damaging 0.99
R8215:Hivep3 UTSW 4 120122901 missense probably damaging 1.00
R8364:Hivep3 UTSW 4 120099442 missense probably benign 0.10
R8467:Hivep3 UTSW 4 120095041 missense probably damaging 0.98
R8768:Hivep3 UTSW 4 120132324 missense probably damaging 0.99
R8890:Hivep3 UTSW 4 120096460 missense possibly damaging 0.95
R8902:Hivep3 UTSW 4 120096740 missense possibly damaging 0.83
R9022:Hivep3 UTSW 4 120098107 missense probably benign 0.09
R9336:Hivep3 UTSW 4 120095203 missense possibly damaging 0.84
R9606:Hivep3 UTSW 4 120132589 missense probably damaging 0.98
RF019:Hivep3 UTSW 4 120098270 missense probably benign 0.12
X0062:Hivep3 UTSW 4 120098698 missense probably damaging 1.00
X0067:Hivep3 UTSW 4 120131787 missense probably damaging 0.96
Z1176:Hivep3 UTSW 4 120133782 missense probably damaging 1.00
Z1177:Hivep3 UTSW 4 120095946 missense possibly damaging 0.68
Z1177:Hivep3 UTSW 4 120131778 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCTGGTACGTCAGGCCTC -3'
(R):5'- TGGAAGGGGATATCTGCAGC -3'

Sequencing Primer
(F):5'- GGCCTCCCTGAACAGACCTC -3'
(R):5'- ATATCTGCAGCGTGAGGC -3'
Posted On 2020-09-15