Incidental Mutation 'R7915:Plxnd1'
ID648012
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Nameplexin D1
Synonymsb2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7915 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location115954811-115995005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115966918 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1140 (D1140G)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
Predicted Effect probably benign
Transcript: ENSMUST00000015511
AA Change: D1140G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: D1140G

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131590
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T C 8: 11,678,645 T9A possibly damaging Het
Abca17 T G 17: 24,265,533 H1585P probably damaging Het
Acaca A T 11: 84,276,588 T1063S probably benign Het
Actc1 T A 2: 114,050,486 K86M probably damaging Het
Amz1 A G 5: 140,741,435 N51S probably benign Het
Arhgap33 G A 7: 30,523,223 P1095S probably benign Het
Bicra T C 7: 15,988,522 T357A probably benign Het
C130032M10Rik A G 9: 114,516,055 R120G unknown Het
Cadps A G 14: 12,705,544 F284L possibly damaging Het
Ccdc83 G A 7: 90,244,082 Q156* probably null Het
Cdh20 T A 1: 104,934,173 M26K probably benign Het
Cdh23 A G 10: 60,307,889 L2979P probably damaging Het
Crocc2 T C 1: 93,213,641 L1172P probably damaging Het
Cyp2d10 C T 15: 82,404,427 probably null Het
Cyp2j9 T A 4: 96,591,384 probably benign Het
Dgcr2 A G 16: 17,859,402 probably null Het
Dio3 A G 12: 110,280,039 M270V Het
Dll1 C A 17: 15,368,428 D662Y probably damaging Het
Drd1 G T 13: 54,053,815 P127T probably damaging Het
Evc2 T C 5: 37,386,862 S652P probably damaging Het
Fam149a C A 8: 45,341,243 M708I probably benign Het
Fam89a T C 8: 124,741,156 E139G probably damaging Het
Gm13088 T C 4: 143,655,745 K127R possibly damaging Het
Gm28710 A G 5: 16,827,014 N556D probably benign Het
Gpr141 T C 13: 19,752,559 I15M probably benign Het
Hcn4 G A 9: 58,823,935 E142K unknown Het
Hivep3 T A 4: 120,097,765 S1093T possibly damaging Het
Inpp5f C A 7: 128,667,709 T261K probably benign Het
Ints3 A T 3: 90,432,825 D42E probably benign Het
Krt90 A T 15: 101,558,403 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrig1 C A 6: 94,630,101 probably null Het
Mapk14 A G 17: 28,728,954 T221A probably benign Het
Megf10 A T 18: 57,240,735 T202S probably benign Het
Neo1 A T 9: 58,930,981 F507I probably benign Het
Olfr1084 T A 2: 86,638,766 *314L probably null Het
Olfr1351 A G 10: 79,017,430 Y36C probably damaging Het
Olfr912 A T 9: 38,581,673 Y132F probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pkd1 T A 17: 24,592,656 Y3724* probably null Het
Prex1 A G 2: 166,621,192 S250P probably damaging Het
Prom1 A T 5: 44,004,935 M777K possibly damaging Het
Prrc2c A C 1: 162,692,408 S2125A probably benign Het
Ptpn12 A G 5: 21,009,451 I229T probably damaging Het
Ranbp6 A G 19: 29,812,673 V93A probably benign Het
Rtn3 A G 19: 7,457,500 C376R probably benign Het
Sis A C 3: 72,921,138 H1201Q probably damaging Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Slc3a2 G A 19: 8,707,818 R535W probably damaging Het
Slc5a2 T A 7: 128,265,794 L33Q probably damaging Het
Sltm G T 9: 70,587,149 R927L probably damaging Het
Stat1 A G 1: 52,151,281 D565G probably benign Het
Terb1 T C 8: 104,447,216 K745R possibly damaging Het
Tescl T C 7: 24,333,688 I71V probably damaging Het
Tgm1 T C 14: 55,700,426 D742G probably damaging Het
Tmem128 T A 5: 38,266,531 W30R probably benign Het
Tox T A 4: 6,822,949 M123L probably benign Het
Tsnaxip1 A G 8: 105,842,781 S547G possibly damaging Het
Ttn T A 2: 76,737,195 K27785* probably null Het
Usp38 A C 8: 81,001,083 S340R probably damaging Het
Utrn A T 10: 12,465,212 H2840Q probably damaging Het
Vars2 T C 17: 35,664,839 I229V probably damaging Het
Vmn1r16 A T 6: 57,323,395 Y81N probably damaging Het
Vmn2r98 A T 17: 19,067,231 D442V probably benign Het
Vps13d T C 4: 145,086,819 I3296V Het
Wwtr1 A G 3: 57,575,599 probably null Het
Zcchc6 T C 13: 59,784,814 I1345V probably benign Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCACATGGATGACGAGGGTG -3'
(R):5'- GTGAGATGGTCCTATGCAGC -3'

Sequencing Primer
(F):5'- GTGAGCGGCTCTCCTGG -3'
(R):5'- TATGCAGCCAGGGTCCTGAAG -3'
Posted On2020-09-15