Incidental Mutation 'R7915:Vmn2r98'
ID 648043
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission 045963-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7915 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19287493 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 442 (D442V)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: D442V

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: D442V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T G 17: 24,484,507 (GRCm39) H1585P probably damaging Het
Acaca A T 11: 84,167,414 (GRCm39) T1063S probably benign Het
Actc1 T A 2: 113,880,967 (GRCm39) K86M probably damaging Het
Amz1 A G 5: 140,727,190 (GRCm39) N51S probably benign Het
Arhgap33 G A 7: 30,222,648 (GRCm39) P1095S probably benign Het
Bicra T C 7: 15,722,447 (GRCm39) T357A probably benign Het
C130032M10Rik A G 9: 114,345,123 (GRCm39) R120G unknown Het
Cadps A G 14: 12,705,544 (GRCm38) F284L possibly damaging Het
Ccdc83 G A 7: 89,893,290 (GRCm39) Q156* probably null Het
Cdh20 T A 1: 104,861,898 (GRCm39) M26K probably benign Het
Cdh23 A G 10: 60,143,668 (GRCm39) L2979P probably damaging Het
Cdhr17 A G 5: 17,032,012 (GRCm39) N556D probably benign Het
Crocc2 T C 1: 93,141,363 (GRCm39) L1172P probably damaging Het
Cyp2d10 C T 15: 82,288,628 (GRCm39) probably null Het
Cyp2j9 T A 4: 96,479,621 (GRCm39) probably benign Het
Dgcr2 A G 16: 17,677,266 (GRCm39) probably null Het
Dio3 A G 12: 110,246,473 (GRCm39) M270V Het
Dll1 C A 17: 15,588,690 (GRCm39) D662Y probably damaging Het
Drd1 G T 13: 54,207,834 (GRCm39) P127T probably damaging Het
Evc2 T C 5: 37,544,206 (GRCm39) S652P probably damaging Het
Fam149a C A 8: 45,794,280 (GRCm39) M708I probably benign Het
Fam89a T C 8: 125,467,895 (GRCm39) E139G probably damaging Het
Gpr141 T C 13: 19,936,729 (GRCm39) I15M probably benign Het
Hcn4 G A 9: 58,731,218 (GRCm39) E142K unknown Het
Hivep3 T A 4: 119,954,962 (GRCm39) S1093T possibly damaging Het
Inpp5f C A 7: 128,269,433 (GRCm39) T261K probably benign Het
Ints3 A T 3: 90,340,132 (GRCm39) D42E probably benign Het
Krt90 A T 15: 101,466,838 (GRCm39) probably null Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Lrig1 C A 6: 94,607,082 (GRCm39) probably null Het
Mapk14 A G 17: 28,947,928 (GRCm39) T221A probably benign Het
Megf10 A T 18: 57,373,807 (GRCm39) T202S probably benign Het
Neo1 A T 9: 58,838,264 (GRCm39) F507I probably benign Het
Or7a35 A G 10: 78,853,264 (GRCm39) Y36C probably damaging Het
Or8b48 A T 9: 38,492,969 (GRCm39) Y132F probably damaging Het
Or8k37 T A 2: 86,469,110 (GRCm39) *314L probably null Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Pkd1 T A 17: 24,811,630 (GRCm39) Y3724* probably null Het
Plxnd1 T C 6: 115,943,879 (GRCm39) D1140G probably benign Het
Pramel22 T C 4: 143,382,315 (GRCm39) K127R possibly damaging Het
Prex1 A G 2: 166,463,112 (GRCm39) S250P probably damaging Het
Prom1 A T 5: 44,162,277 (GRCm39) M777K possibly damaging Het
Prrc2c A C 1: 162,519,977 (GRCm39) S2125A probably benign Het
Ptpn12 A G 5: 21,214,449 (GRCm39) I229T probably damaging Het
Ranbp6 A G 19: 29,790,073 (GRCm39) V93A probably benign Het
Rtn3 A G 19: 7,434,865 (GRCm39) C376R probably benign Het
Sis A C 3: 72,828,471 (GRCm39) H1201Q probably damaging Het
Slc20a1 G A 2: 129,049,757 (GRCm39) D340N probably benign Het
Slc3a2 G A 19: 8,685,182 (GRCm39) R535W probably damaging Het
Slc5a2 T A 7: 127,864,966 (GRCm39) L33Q probably damaging Het
Sltm G T 9: 70,494,431 (GRCm39) R927L probably damaging Het
Spaca7b T C 8: 11,728,645 (GRCm39) T9A possibly damaging Het
Stat1 A G 1: 52,190,440 (GRCm39) D565G probably benign Het
Terb1 T C 8: 105,173,848 (GRCm39) K745R possibly damaging Het
Tescl T C 7: 24,033,113 (GRCm39) I71V probably damaging Het
Tgm1 T C 14: 55,937,883 (GRCm39) D742G probably damaging Het
Tmem128 T A 5: 38,423,875 (GRCm39) W30R probably benign Het
Tox T A 4: 6,822,949 (GRCm39) M123L probably benign Het
Tsnaxip1 A G 8: 106,569,413 (GRCm39) S547G possibly damaging Het
Ttn T A 2: 76,567,539 (GRCm39) K27785* probably null Het
Tut7 T C 13: 59,932,628 (GRCm39) I1345V probably benign Het
Usp38 A C 8: 81,727,712 (GRCm39) S340R probably damaging Het
Utrn A T 10: 12,340,956 (GRCm39) H2840Q probably damaging Het
Vars2 T C 17: 35,975,731 (GRCm39) I229V probably damaging Het
Vmn1r16 A T 6: 57,300,380 (GRCm39) Y81N probably damaging Het
Vps13d T C 4: 144,813,389 (GRCm39) I3296V Het
Wwtr1 A G 3: 57,483,020 (GRCm39) probably null Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0545:Vmn2r98 UTSW 17 19,273,875 (GRCm39) missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19,300,887 (GRCm39) missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19,290,007 (GRCm39) missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19,301,031 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R8952:Vmn2r98 UTSW 17 19,285,531 (GRCm39) missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19,301,496 (GRCm39) missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGATTGCTCACTTGAACTTGG -3'
(R):5'- CCACCTCTGAAAATATTGCTGGC -3'

Sequencing Primer
(F):5'- GCTCACTTGAACTTGGTTCTAAG -3'
(R):5'- CCTCTGAAAATATTGCTGGCCATTG -3'
Posted On 2020-09-15