Incidental Mutation 'R7916:Tmem131'
ID648052
Institutional Source Beutler Lab
Gene Symbol Tmem131
Ensembl Gene ENSMUSG00000026116
Gene Nametransmembrane protein 131
Synonyms2610524E03Rik, D1Bwg0491e, CC28, Neg, Rw1, YR-23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R7916 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location36792191-36943666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36823086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 677 (V677A)
Ref Sequence ENSEMBL: ENSMUSP00000027290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027290] [ENSMUST00000186486] [ENSMUST00000189470] [ENSMUST00000190442] [ENSMUST00000194563]
Predicted Effect probably benign
Transcript: ENSMUST00000027290
AA Change: V677A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027290
Gene: ENSMUSG00000026116
AA Change: V677A

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:TMEM131_like 106 189 1.7e-32 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186486
SMART Domains Protein: ENSMUSP00000142080
Gene: ENSMUSG00000026116

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189470
Predicted Effect probably benign
Transcript: ENSMUST00000190442
Predicted Effect probably benign
Transcript: ENSMUST00000194563
AA Change: V677A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142307
Gene: ENSMUSG00000026116
AA Change: V677A

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:DUF3651 170 243 1.9e-27 PFAM
Pfam:DUF3651 500 580 4.5e-16 PFAM
Pfam:DUF3651 631 706 5.2e-15 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,864,590 L195* probably null Het
Ahnak T G 19: 9,005,832 D1493E possibly damaging Het
Alox12e C A 11: 70,321,285 R162L probably benign Het
Bax T G 7: 45,466,115 Q32P probably benign Het
BC003331 C T 1: 150,384,498 R123K probably benign Het
Cand1 A G 10: 119,216,588 M204T probably benign Het
Chd9 T A 8: 91,035,056 Y2256* probably null Het
Chuk A G 19: 44,096,981 I242T probably damaging Het
Cic T C 7: 25,288,290 S1468P probably damaging Het
Col27a1 A G 4: 63,224,552 H159R probably damaging Het
Cux1 T C 5: 136,282,961 K1174E probably damaging Het
Dnah2 C A 11: 69,421,148 probably null Het
Dpp3 C A 19: 4,917,024 E351* probably null Het
Dyrk1a A G 16: 94,673,341 Y319C probably damaging Het
E130308A19Rik T C 4: 59,719,841 S458P probably damaging Het
Ehmt1 G A 2: 24,856,696 L425F probably damaging Het
Emp2 C A 16: 10,284,573 R125L possibly damaging Het
Farsb A G 1: 78,458,563 probably null Het
Frk A T 10: 34,484,025 R7S possibly damaging Het
Glb1l2 T C 9: 26,767,424 T483A probably benign Het
Gm5773 T C 3: 93,773,279 V86A possibly damaging Het
Gm7324 T G 14: 43,714,546 D215E probably benign Het
Gng13 A T 17: 25,718,958 K44* probably null Het
Gprin1 C T 13: 54,739,450 G337D possibly damaging Het
Ighv1-84 G T 12: 115,980,989 Q22K probably benign Het
Il20rb T C 9: 100,466,251 H210R probably benign Het
Iqcm C T 8: 75,577,950 S113L probably benign Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kmo G T 1: 175,659,670 G430W probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Ldhd T G 8: 111,629,391 D120A possibly damaging Het
Lyst T C 13: 13,647,072 S1344P possibly damaging Het
Mb T A 15: 77,016,057 I112F probably damaging Het
Mbd5 G A 2: 49,257,106 V443M probably damaging Het
Milr1 A G 11: 106,763,862 K180R possibly damaging Het
Mst1r T C 9: 107,907,578 F145S probably damaging Het
Mthfd2 A T 6: 83,309,473 I251K possibly damaging Het
Nfx1 T A 4: 40,977,142 M272K probably benign Het
Nlrp3 A G 11: 59,551,863 D747G probably benign Het
Olfr1049 A T 2: 86,254,858 Y278* probably null Het
Olfr1385 A T 11: 49,494,716 Y61F probably benign Het
Olfr484 C A 7: 108,125,122 S47I possibly damaging Het
Pcdha11 A G 18: 37,007,388 E690G probably benign Het
Pcdhga4 T A 18: 37,685,449 I17N probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf20 A G 2: 156,287,938 K477E probably damaging Het
Pik3c2b T A 1: 133,100,904 I1377N probably benign Het
Polr3h T C 15: 81,922,412 K69E probably benign Het
Rpgrip1 A G 14: 52,131,184 H280R possibly damaging Het
Rpp40 C A 13: 35,902,051 R132L probably benign Het
Ryr1 G A 7: 29,090,939 Q1488* probably null Het
Sh3bp1 A G 15: 78,907,221 M403V probably benign Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Snrnp200 T A 2: 127,233,059 N1517K possibly damaging Het
Srek1ip1 T A 13: 104,837,473 H129Q possibly damaging Het
Thumpd2 A T 17: 81,026,687 C491S probably benign Het
Tle3 A T 9: 61,407,128 N204I probably benign Het
Topaz1 T G 9: 122,747,434 L30R probably benign Het
Trim35 T A 14: 66,308,860 C359S probably damaging Het
Ttn A C 2: 76,944,521 V2105G unknown Het
Ube2o A G 11: 116,581,058 V119A probably benign Het
Ubr2 A T 17: 46,968,382 probably null Het
Uhmk1 A G 1: 170,205,188 V347A possibly damaging Het
Utp4 C T 8: 106,922,865 P649S probably damaging Het
Vmn2r28 G A 7: 5,480,819 T794I probably damaging Het
Vmn2r61 T G 7: 42,300,511 F785C probably damaging Het
Xpot C A 10: 121,622,943 probably benign Het
Zfp729a C T 13: 67,620,175 R645H probably benign Het
Other mutations in Tmem131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tmem131 APN 1 36811427 missense probably damaging 1.00
IGL00945:Tmem131 APN 1 36827005 splice site probably benign
IGL01107:Tmem131 APN 1 36829581 missense probably damaging 1.00
IGL01401:Tmem131 APN 1 36799387 missense probably damaging 1.00
IGL01533:Tmem131 APN 1 36818722 missense probably damaging 1.00
IGL01701:Tmem131 APN 1 36808237 missense probably benign 0.02
IGL01784:Tmem131 APN 1 36815483 missense probably damaging 1.00
IGL01890:Tmem131 APN 1 36823156 splice site probably benign
IGL01969:Tmem131 APN 1 36825460 missense possibly damaging 0.85
IGL02327:Tmem131 APN 1 36799022 missense probably damaging 1.00
IGL02707:Tmem131 APN 1 36825479 missense probably benign 0.03
IGL02743:Tmem131 APN 1 36793151 missense probably benign 0.00
IGL03111:Tmem131 APN 1 36828144 missense probably damaging 1.00
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0238:Tmem131 UTSW 1 36828050 splice site probably benign
R0239:Tmem131 UTSW 1 36828050 splice site probably benign
R0499:Tmem131 UTSW 1 36841673 missense probably damaging 1.00
R0548:Tmem131 UTSW 1 36838038 missense probably damaging 1.00
R0845:Tmem131 UTSW 1 36816222 missense probably damaging 1.00
R0975:Tmem131 UTSW 1 36854885 missense probably damaging 1.00
R1018:Tmem131 UTSW 1 36794819 missense probably damaging 0.98
R1170:Tmem131 UTSW 1 36834898 nonsense probably null
R1443:Tmem131 UTSW 1 36825478 missense probably damaging 0.98
R1448:Tmem131 UTSW 1 36827358 missense probably benign 0.16
R1472:Tmem131 UTSW 1 36816241 missense possibly damaging 0.68
R1530:Tmem131 UTSW 1 36827009 critical splice donor site probably null
R1672:Tmem131 UTSW 1 36824759 missense probably damaging 1.00
R1872:Tmem131 UTSW 1 36807927 missense probably benign 0.05
R1914:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1915:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1929:Tmem131 UTSW 1 36812271 missense possibly damaging 0.50
R1971:Tmem131 UTSW 1 36804599 nonsense probably null
R2146:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2148:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2149:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2150:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2386:Tmem131 UTSW 1 36829635 missense probably benign 0.00
R2879:Tmem131 UTSW 1 36841707 missense possibly damaging 0.76
R2903:Tmem131 UTSW 1 36825297 missense probably damaging 1.00
R3430:Tmem131 UTSW 1 36808821 splice site probably benign
R3821:Tmem131 UTSW 1 36808396 missense probably damaging 0.99
R3961:Tmem131 UTSW 1 36818950 missense probably damaging 1.00
R4153:Tmem131 UTSW 1 36808793 intron probably benign
R4154:Tmem131 UTSW 1 36808793 intron probably benign
R4502:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4503:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4795:Tmem131 UTSW 1 36841676 missense probably damaging 1.00
R5030:Tmem131 UTSW 1 36827174 missense possibly damaging 0.78
R5068:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5070:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5386:Tmem131 UTSW 1 36872558 missense possibly damaging 0.47
R5507:Tmem131 UTSW 1 36889280 missense probably damaging 1.00
R5569:Tmem131 UTSW 1 36799338 missense probably benign 0.02
R5913:Tmem131 UTSW 1 36819128 missense probably benign 0.01
R6044:Tmem131 UTSW 1 36881341 nonsense probably null
R6125:Tmem131 UTSW 1 36808306 missense possibly damaging 0.95
R6259:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R6392:Tmem131 UTSW 1 36881342 missense probably benign 0.10
R6704:Tmem131 UTSW 1 36796180 missense possibly damaging 0.77
R6828:Tmem131 UTSW 1 36804643 missense possibly damaging 0.46
R6964:Tmem131 UTSW 1 36796292 missense probably damaging 0.99
R7034:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7036:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7081:Tmem131 UTSW 1 36889295 missense possibly damaging 0.94
R7278:Tmem131 UTSW 1 36796301 missense probably damaging 0.99
R7282:Tmem131 UTSW 1 36841604 missense probably damaging 1.00
R7294:Tmem131 UTSW 1 36854847 missense possibly damaging 0.88
R7635:Tmem131 UTSW 1 36872548 missense probably damaging 1.00
R7948:Tmem131 UTSW 1 36794148 missense probably damaging 1.00
R8012:Tmem131 UTSW 1 36807964 missense probably damaging 1.00
R8244:Tmem131 UTSW 1 36808893 missense probably benign 0.08
R8461:Tmem131 UTSW 1 36794821 missense probably damaging 1.00
R8902:Tmem131 UTSW 1 36808965 missense not run
R8915:Tmem131 UTSW 1 36829577 missense not run
Z1176:Tmem131 UTSW 1 36796257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGGTCTATTGCTCATCCCAC -3'
(R):5'- TAGCAGGTAAATGAGTAGTCACTGG -3'

Sequencing Primer
(F):5'- ACTTTCCATTCTCTTAAGAACCTGG -3'
(R):5'- CCTTGGGCAGATTAAAAAGTTTCCAG -3'
Posted On2020-09-15