Incidental Mutation 'R7916:Nfx1'
ID 648066
Institutional Source Beutler Lab
Gene Symbol Nfx1
Ensembl Gene ENSMUSG00000028423
Gene Name nuclear transcription factor, X-box binding 1
Synonyms Tex42, 3000003M19Rik, 1300017N15Rik, TEG-42
MMRRC Submission 045964-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.602) question?
Stock # R7916 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 40970906-41025992 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40977142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 272 (M272K)
Ref Sequence ENSEMBL: ENSMUSP00000095747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]
AlphaFold B1AY10
Predicted Effect probably benign
Transcript: ENSMUST00000030133
AA Change: M272K

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423
AA Change: M272K

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091614
AA Change: M272K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423
AA Change: M272K

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098143
AA Change: M272K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: M272K

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
ZnF_NFX 826 848 7.7e-5 SMART
ZnF_NFX 857 878 4.23e-2 SMART
coiled coil region 930 956 N/A INTRINSIC
R3H 977 1055 1.38e-22 SMART
low complexity region 1070 1088 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,682,454 (GRCm39) L195* probably null Het
Ahnak T G 19: 8,983,196 (GRCm39) D1493E possibly damaging Het
Alox12e C A 11: 70,212,111 (GRCm39) R162L probably benign Het
Bax T G 7: 45,115,539 (GRCm39) Q32P probably benign Het
Cand1 A G 10: 119,052,493 (GRCm39) M204T probably benign Het
Chd9 T A 8: 91,761,684 (GRCm39) Y2256* probably null Het
Chuk A G 19: 44,085,420 (GRCm39) I242T probably damaging Het
Cic T C 7: 24,987,715 (GRCm39) S1468P probably damaging Het
Col27a1 A G 4: 63,142,789 (GRCm39) H159R probably damaging Het
Cux1 T C 5: 136,311,815 (GRCm39) K1174E probably damaging Het
Dnah2 C A 11: 69,311,974 (GRCm39) probably null Het
Dpp3 C A 19: 4,967,052 (GRCm39) E351* probably null Het
Dyrk1a A G 16: 94,474,200 (GRCm39) Y319C probably damaging Het
E130308A19Rik T C 4: 59,719,841 (GRCm39) S458P probably damaging Het
Ehmt1 G A 2: 24,746,708 (GRCm39) L425F probably damaging Het
Emp2 C A 16: 10,102,437 (GRCm39) R125L possibly damaging Het
Farsb A G 1: 78,435,200 (GRCm39) probably null Het
Frk A T 10: 34,360,021 (GRCm39) R7S possibly damaging Het
Glb1l2 T C 9: 26,678,720 (GRCm39) T483A probably benign Het
Gm5773 T C 3: 93,680,586 (GRCm39) V86A possibly damaging Het
Gm7324 T G 14: 43,952,003 (GRCm39) D215E probably benign Het
Gng13 A T 17: 25,937,932 (GRCm39) K44* probably null Het
Gprin1 C T 13: 54,887,263 (GRCm39) G337D possibly damaging Het
Ighv1-84 G T 12: 115,944,609 (GRCm39) Q22K probably benign Het
Il20rb T C 9: 100,348,304 (GRCm39) H210R probably benign Het
Iqcm C T 8: 76,304,578 (GRCm39) S113L probably benign Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,712,417 (GRCm39) probably benign Het
Kmo G T 1: 175,487,236 (GRCm39) G430W probably damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Ldhd T G 8: 112,356,023 (GRCm39) D120A possibly damaging Het
Lyst T C 13: 13,821,657 (GRCm39) S1344P possibly damaging Het
Mb T A 15: 76,900,257 (GRCm39) I112F probably damaging Het
Mbd5 G A 2: 49,147,118 (GRCm39) V443M probably damaging Het
Milr1 A G 11: 106,654,688 (GRCm39) K180R possibly damaging Het
Mst1r T C 9: 107,784,777 (GRCm39) F145S probably damaging Het
Mthfd2 A T 6: 83,286,455 (GRCm39) I251K possibly damaging Het
Nlrp3 A G 11: 59,442,689 (GRCm39) D747G probably benign Het
Odr4 C T 1: 150,260,249 (GRCm39) R123K probably benign Het
Or2y1 A T 11: 49,385,543 (GRCm39) Y61F probably benign Het
Or5p60 C A 7: 107,724,329 (GRCm39) S47I possibly damaging Het
Or8k18 A T 2: 86,085,202 (GRCm39) Y278* probably null Het
Pcdha11 A G 18: 37,140,441 (GRCm39) E690G probably benign Het
Pcdhga4 T A 18: 37,818,502 (GRCm39) I17N probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phf20 A G 2: 156,129,858 (GRCm39) K477E probably damaging Het
Pik3c2b T A 1: 133,028,642 (GRCm39) I1377N probably benign Het
Polr3h T C 15: 81,806,613 (GRCm39) K69E probably benign Het
Rpgrip1 A G 14: 52,368,641 (GRCm39) H280R possibly damaging Het
Rpp40 C A 13: 36,086,034 (GRCm39) R132L probably benign Het
Ryr1 G A 7: 28,790,364 (GRCm39) Q1488* probably null Het
Sh3bp1 A G 15: 78,791,421 (GRCm39) M403V probably benign Het
Slc20a1 G A 2: 129,049,757 (GRCm39) D340N probably benign Het
Snrnp200 T A 2: 127,074,979 (GRCm39) N1517K possibly damaging Het
Srek1ip1 T A 13: 104,973,981 (GRCm39) H129Q possibly damaging Het
Thumpd2 A T 17: 81,334,116 (GRCm39) C491S probably benign Het
Tle3 A T 9: 61,314,410 (GRCm39) N204I probably benign Het
Tmem131 A G 1: 36,862,167 (GRCm39) V677A probably benign Het
Topaz1 T G 9: 122,576,499 (GRCm39) L30R probably benign Het
Trim35 T A 14: 66,546,309 (GRCm39) C359S probably damaging Het
Ttn A C 2: 76,774,865 (GRCm39) V2105G unknown Het
Ube2o A G 11: 116,471,884 (GRCm39) V119A probably benign Het
Ubr2 A T 17: 47,279,308 (GRCm39) probably null Het
Uhmk1 A G 1: 170,032,757 (GRCm39) V347A possibly damaging Het
Utp4 C T 8: 107,649,497 (GRCm39) P649S probably damaging Het
Vmn2r28 G A 7: 5,483,818 (GRCm39) T794I probably damaging Het
Vmn2r61 T G 7: 41,949,935 (GRCm39) F785C probably damaging Het
Xpot C A 10: 121,458,848 (GRCm39) probably benign Het
Zfp729a C T 13: 67,768,294 (GRCm39) R645H probably benign Het
Other mutations in Nfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Nfx1 APN 4 40,977,241 (GRCm39) missense probably benign 0.00
IGL01998:Nfx1 APN 4 41,004,353 (GRCm39) missense probably damaging 1.00
IGL02072:Nfx1 APN 4 41,016,119 (GRCm39) missense probably benign
IGL02170:Nfx1 APN 4 41,018,019 (GRCm39) missense probably damaging 1.00
IGL02188:Nfx1 APN 4 40,993,827 (GRCm39) missense probably damaging 1.00
IGL02502:Nfx1 APN 4 40,976,345 (GRCm39) splice site probably benign
IGL02674:Nfx1 APN 4 40,999,717 (GRCm39) critical splice donor site probably null
IGL03007:Nfx1 APN 4 40,984,962 (GRCm39) missense probably benign 0.02
IGL03092:Nfx1 APN 4 41,024,851 (GRCm39) missense probably damaging 1.00
IGL03303:Nfx1 APN 4 41,004,323 (GRCm39) splice site probably benign
K7371:Nfx1 UTSW 4 40,976,803 (GRCm39) missense probably damaging 1.00
PIT4498001:Nfx1 UTSW 4 40,977,244 (GRCm39) missense probably benign
R0032:Nfx1 UTSW 4 41,015,321 (GRCm39) missense probably benign 0.00
R0032:Nfx1 UTSW 4 41,015,321 (GRCm39) missense probably benign 0.00
R0069:Nfx1 UTSW 4 40,986,688 (GRCm39) splice site probably benign
R1056:Nfx1 UTSW 4 41,003,057 (GRCm39) missense probably damaging 0.97
R1449:Nfx1 UTSW 4 40,976,803 (GRCm39) missense probably damaging 1.00
R1635:Nfx1 UTSW 4 40,977,004 (GRCm39) missense probably benign
R1636:Nfx1 UTSW 4 41,016,072 (GRCm39) splice site probably null
R1882:Nfx1 UTSW 4 41,009,240 (GRCm39) missense possibly damaging 0.55
R2089:Nfx1 UTSW 4 40,977,004 (GRCm39) missense probably benign
R2091:Nfx1 UTSW 4 40,977,004 (GRCm39) missense probably benign
R2091:Nfx1 UTSW 4 40,977,004 (GRCm39) missense probably benign
R3792:Nfx1 UTSW 4 41,004,357 (GRCm39) nonsense probably null
R3793:Nfx1 UTSW 4 41,004,357 (GRCm39) nonsense probably null
R4668:Nfx1 UTSW 4 40,976,367 (GRCm39) missense possibly damaging 0.50
R4678:Nfx1 UTSW 4 41,012,070 (GRCm39) missense probably benign 0.01
R4894:Nfx1 UTSW 4 40,996,877 (GRCm39) missense probably damaging 1.00
R4972:Nfx1 UTSW 4 40,976,375 (GRCm39) missense probably benign 0.36
R5066:Nfx1 UTSW 4 40,991,868 (GRCm39) missense probably benign
R5389:Nfx1 UTSW 4 40,985,000 (GRCm39) missense probably damaging 1.00
R5429:Nfx1 UTSW 4 41,004,343 (GRCm39) missense probably damaging 1.00
R5643:Nfx1 UTSW 4 40,984,973 (GRCm39) missense probably null 1.00
R5644:Nfx1 UTSW 4 40,984,973 (GRCm39) missense probably null 1.00
R5915:Nfx1 UTSW 4 40,977,285 (GRCm39) missense probably benign 0.02
R6286:Nfx1 UTSW 4 40,986,728 (GRCm39) missense probably damaging 1.00
R6393:Nfx1 UTSW 4 40,976,851 (GRCm39) missense possibly damaging 0.92
R7409:Nfx1 UTSW 4 41,021,830 (GRCm39) missense possibly damaging 0.64
R7523:Nfx1 UTSW 4 41,016,119 (GRCm39) missense probably benign
R8497:Nfx1 UTSW 4 40,976,968 (GRCm39) missense possibly damaging 0.67
R8799:Nfx1 UTSW 4 41,023,727 (GRCm39) missense probably damaging 1.00
R9154:Nfx1 UTSW 4 40,990,845 (GRCm39) missense probably damaging 1.00
R9364:Nfx1 UTSW 4 41,023,756 (GRCm39) missense probably benign 0.31
R9497:Nfx1 UTSW 4 40,994,104 (GRCm39) missense probably benign 0.00
X0025:Nfx1 UTSW 4 40,976,422 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GACTCTTCAGATGCCTCCTGTAG -3'
(R):5'- TCCAGGCACACTTACTTACCTG -3'

Sequencing Primer
(F):5'- CCTCCTGTAGAAAACCTGTAGTGG -3'
(R):5'- AGGCACACTTACTTACCTGTATGTG -3'
Posted On 2020-09-15