Incidental Mutation 'R7916:E130308A19Rik'
ID648067
Institutional Source Beutler Lab
Gene Symbol E130308A19Rik
Ensembl Gene ENSMUSG00000045071
Gene NameRIKEN cDNA E130308A19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R7916 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location59626211-59761439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59719841 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 458 (S458P)
Ref Sequence ENSEMBL: ENSMUSP00000062493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052420] [ENSMUST00000070150]
Predicted Effect probably damaging
Transcript: ENSMUST00000052420
AA Change: S458P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062493
Gene: ENSMUSG00000045071
AA Change: S458P

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:DUF3504 520 673 2.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070150
SMART Domains Protein: ENSMUSP00000065702
Gene: ENSMUSG00000045071

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
Pfam:DUF3504 532 687 4.5e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,864,590 L195* probably null Het
Ahnak T G 19: 9,005,832 D1493E possibly damaging Het
Alox12e C A 11: 70,321,285 R162L probably benign Het
Bax T G 7: 45,466,115 Q32P probably benign Het
BC003331 C T 1: 150,384,498 R123K probably benign Het
Cand1 A G 10: 119,216,588 M204T probably benign Het
Chd9 T A 8: 91,035,056 Y2256* probably null Het
Chuk A G 19: 44,096,981 I242T probably damaging Het
Cic T C 7: 25,288,290 S1468P probably damaging Het
Col27a1 A G 4: 63,224,552 H159R probably damaging Het
Cux1 T C 5: 136,282,961 K1174E probably damaging Het
Dnah2 C A 11: 69,421,148 probably null Het
Dpp3 C A 19: 4,917,024 E351* probably null Het
Dyrk1a A G 16: 94,673,341 Y319C probably damaging Het
Ehmt1 G A 2: 24,856,696 L425F probably damaging Het
Emp2 C A 16: 10,284,573 R125L possibly damaging Het
Farsb A G 1: 78,458,563 probably null Het
Frk A T 10: 34,484,025 R7S possibly damaging Het
Glb1l2 T C 9: 26,767,424 T483A probably benign Het
Gm5773 T C 3: 93,773,279 V86A possibly damaging Het
Gm7324 T G 14: 43,714,546 D215E probably benign Het
Gng13 A T 17: 25,718,958 K44* probably null Het
Gprin1 C T 13: 54,739,450 G337D possibly damaging Het
Ighv1-84 G T 12: 115,980,989 Q22K probably benign Het
Il20rb T C 9: 100,466,251 H210R probably benign Het
Iqcm C T 8: 75,577,950 S113L probably benign Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kmo G T 1: 175,659,670 G430W probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Ldhd T G 8: 111,629,391 D120A possibly damaging Het
Lyst T C 13: 13,647,072 S1344P possibly damaging Het
Mb T A 15: 77,016,057 I112F probably damaging Het
Mbd5 G A 2: 49,257,106 V443M probably damaging Het
Milr1 A G 11: 106,763,862 K180R possibly damaging Het
Mst1r T C 9: 107,907,578 F145S probably damaging Het
Mthfd2 A T 6: 83,309,473 I251K possibly damaging Het
Nfx1 T A 4: 40,977,142 M272K probably benign Het
Nlrp3 A G 11: 59,551,863 D747G probably benign Het
Olfr1049 A T 2: 86,254,858 Y278* probably null Het
Olfr1385 A T 11: 49,494,716 Y61F probably benign Het
Olfr484 C A 7: 108,125,122 S47I possibly damaging Het
Pcdha11 A G 18: 37,007,388 E690G probably benign Het
Pcdhga4 T A 18: 37,685,449 I17N probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf20 A G 2: 156,287,938 K477E probably damaging Het
Pik3c2b T A 1: 133,100,904 I1377N probably benign Het
Polr3h T C 15: 81,922,412 K69E probably benign Het
Rpgrip1 A G 14: 52,131,184 H280R possibly damaging Het
Rpp40 C A 13: 35,902,051 R132L probably benign Het
Ryr1 G A 7: 29,090,939 Q1488* probably null Het
Sh3bp1 A G 15: 78,907,221 M403V probably benign Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Snrnp200 T A 2: 127,233,059 N1517K possibly damaging Het
Srek1ip1 T A 13: 104,837,473 H129Q possibly damaging Het
Thumpd2 A T 17: 81,026,687 C491S probably benign Het
Tle3 A T 9: 61,407,128 N204I probably benign Het
Tmem131 A G 1: 36,823,086 V677A probably benign Het
Topaz1 T G 9: 122,747,434 L30R probably benign Het
Trim35 T A 14: 66,308,860 C359S probably damaging Het
Ttn A C 2: 76,944,521 V2105G unknown Het
Ube2o A G 11: 116,581,058 V119A probably benign Het
Ubr2 A T 17: 46,968,382 probably null Het
Uhmk1 A G 1: 170,205,188 V347A possibly damaging Het
Utp4 C T 8: 106,922,865 P649S probably damaging Het
Vmn2r28 G A 7: 5,480,819 T794I probably damaging Het
Vmn2r61 T G 7: 42,300,511 F785C probably damaging Het
Xpot C A 10: 121,622,943 probably benign Het
Zfp729a C T 13: 67,620,175 R645H probably benign Het
Other mutations in E130308A19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:E130308A19Rik APN 4 59737743 splice site probably benign
IGL00672:E130308A19Rik APN 4 59719697 missense probably benign 0.00
IGL00937:E130308A19Rik APN 4 59690846 missense probably benign 0.01
IGL01885:E130308A19Rik APN 4 59720004 missense probably benign 0.20
IGL02638:E130308A19Rik APN 4 59719676 nonsense probably null
H8562:E130308A19Rik UTSW 4 59691033 missense possibly damaging 0.70
R0044:E130308A19Rik UTSW 4 59690290 missense possibly damaging 0.86
R0523:E130308A19Rik UTSW 4 59719716 missense probably damaging 0.98
R0788:E130308A19Rik UTSW 4 59719847 missense possibly damaging 0.76
R1215:E130308A19Rik UTSW 4 59690743 missense probably benign 0.37
R1490:E130308A19Rik UTSW 4 59719746 missense probably damaging 0.99
R2292:E130308A19Rik UTSW 4 59690579 missense probably damaging 0.99
R3907:E130308A19Rik UTSW 4 59752393 missense probably benign 0.14
R4288:E130308A19Rik UTSW 4 59690308 missense probably benign 0.33
R4780:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4781:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4834:E130308A19Rik UTSW 4 59690317 nonsense probably null
R4985:E130308A19Rik UTSW 4 59691017 missense probably benign 0.01
R6123:E130308A19Rik UTSW 4 59737565 missense probably damaging 1.00
R6290:E130308A19Rik UTSW 4 59691332 missense probably benign 0.25
R6315:E130308A19Rik UTSW 4 59691132 missense probably benign
R6643:E130308A19Rik UTSW 4 59720561 missense possibly damaging 0.90
R6763:E130308A19Rik UTSW 4 59752288 missense probably damaging 0.99
R6980:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7036:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7078:E130308A19Rik UTSW 4 59737688 missense probably damaging 1.00
R7098:E130308A19Rik UTSW 4 59753004 missense possibly damaging 0.88
R7171:E130308A19Rik UTSW 4 59690333 missense probably damaging 1.00
R7247:E130308A19Rik UTSW 4 59690502 missense probably damaging 1.00
R7366:E130308A19Rik UTSW 4 59752770 missense probably damaging 0.99
R8050:E130308A19Rik UTSW 4 59719767 missense probably damaging 1.00
R8445:E130308A19Rik UTSW 4 59720526 missense probably damaging 0.99
Z1176:E130308A19Rik UTSW 4 59720313 missense probably damaging 1.00
Z1177:E130308A19Rik UTSW 4 59720223 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTTTGTTGCAGACCAGGATG -3'
(R):5'- AAGGTGAGCTTCATGGACTTG -3'

Sequencing Primer
(F):5'- TTTGTTGCAGACCAGGATGAAAGAG -3'
(R):5'- AGCTTCATGGACTTGTGTGGC -3'
Posted On2020-09-15