Incidental Mutation 'R7916:Vmn2r61'
ID 648077
Institutional Source Beutler Lab
Gene Symbol Vmn2r61
Ensembl Gene ENSMUSG00000090967
Gene Name vomeronasal 2, receptor 61
Synonyms Gprc2a-rs2, Casr-rs2, EG637873
MMRRC Submission 045964-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R7916 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 41909477-41950179 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 41949935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Cysteine at position 785 (F785C)
Ref Sequence ENSEMBL: ENSMUSP00000129576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166131]
AlphaFold L7N2B8
Predicted Effect probably damaging
Transcript: ENSMUST00000166131
AA Change: F785C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129576
Gene: ENSMUSG00000090967
AA Change: F785C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 4e-42 PFAM
Pfam:NCD3G 514 567 1.9e-21 PFAM
Pfam:7tm_3 600 835 6.2e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173044
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,682,454 (GRCm39) L195* probably null Het
Ahnak T G 19: 8,983,196 (GRCm39) D1493E possibly damaging Het
Alox12e C A 11: 70,212,111 (GRCm39) R162L probably benign Het
Bax T G 7: 45,115,539 (GRCm39) Q32P probably benign Het
Cand1 A G 10: 119,052,493 (GRCm39) M204T probably benign Het
Chd9 T A 8: 91,761,684 (GRCm39) Y2256* probably null Het
Chuk A G 19: 44,085,420 (GRCm39) I242T probably damaging Het
Cic T C 7: 24,987,715 (GRCm39) S1468P probably damaging Het
Col27a1 A G 4: 63,142,789 (GRCm39) H159R probably damaging Het
Cux1 T C 5: 136,311,815 (GRCm39) K1174E probably damaging Het
Dnah2 C A 11: 69,311,974 (GRCm39) probably null Het
Dpp3 C A 19: 4,967,052 (GRCm39) E351* probably null Het
Dyrk1a A G 16: 94,474,200 (GRCm39) Y319C probably damaging Het
E130308A19Rik T C 4: 59,719,841 (GRCm39) S458P probably damaging Het
Ehmt1 G A 2: 24,746,708 (GRCm39) L425F probably damaging Het
Emp2 C A 16: 10,102,437 (GRCm39) R125L possibly damaging Het
Farsb A G 1: 78,435,200 (GRCm39) probably null Het
Frk A T 10: 34,360,021 (GRCm39) R7S possibly damaging Het
Glb1l2 T C 9: 26,678,720 (GRCm39) T483A probably benign Het
Gm5773 T C 3: 93,680,586 (GRCm39) V86A possibly damaging Het
Gm7324 T G 14: 43,952,003 (GRCm39) D215E probably benign Het
Gng13 A T 17: 25,937,932 (GRCm39) K44* probably null Het
Gprin1 C T 13: 54,887,263 (GRCm39) G337D possibly damaging Het
Ighv1-84 G T 12: 115,944,609 (GRCm39) Q22K probably benign Het
Il20rb T C 9: 100,348,304 (GRCm39) H210R probably benign Het
Iqcm C T 8: 76,304,578 (GRCm39) S113L probably benign Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,712,417 (GRCm39) probably benign Het
Kmo G T 1: 175,487,236 (GRCm39) G430W probably damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Ldhd T G 8: 112,356,023 (GRCm39) D120A possibly damaging Het
Lyst T C 13: 13,821,657 (GRCm39) S1344P possibly damaging Het
Mb T A 15: 76,900,257 (GRCm39) I112F probably damaging Het
Mbd5 G A 2: 49,147,118 (GRCm39) V443M probably damaging Het
Milr1 A G 11: 106,654,688 (GRCm39) K180R possibly damaging Het
Mst1r T C 9: 107,784,777 (GRCm39) F145S probably damaging Het
Mthfd2 A T 6: 83,286,455 (GRCm39) I251K possibly damaging Het
Nfx1 T A 4: 40,977,142 (GRCm39) M272K probably benign Het
Nlrp3 A G 11: 59,442,689 (GRCm39) D747G probably benign Het
Odr4 C T 1: 150,260,249 (GRCm39) R123K probably benign Het
Or2y1 A T 11: 49,385,543 (GRCm39) Y61F probably benign Het
Or5p60 C A 7: 107,724,329 (GRCm39) S47I possibly damaging Het
Or8k18 A T 2: 86,085,202 (GRCm39) Y278* probably null Het
Pcdha11 A G 18: 37,140,441 (GRCm39) E690G probably benign Het
Pcdhga4 T A 18: 37,818,502 (GRCm39) I17N probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phf20 A G 2: 156,129,858 (GRCm39) K477E probably damaging Het
Pik3c2b T A 1: 133,028,642 (GRCm39) I1377N probably benign Het
Polr3h T C 15: 81,806,613 (GRCm39) K69E probably benign Het
Rpgrip1 A G 14: 52,368,641 (GRCm39) H280R possibly damaging Het
Rpp40 C A 13: 36,086,034 (GRCm39) R132L probably benign Het
Ryr1 G A 7: 28,790,364 (GRCm39) Q1488* probably null Het
Sh3bp1 A G 15: 78,791,421 (GRCm39) M403V probably benign Het
Slc20a1 G A 2: 129,049,757 (GRCm39) D340N probably benign Het
Snrnp200 T A 2: 127,074,979 (GRCm39) N1517K possibly damaging Het
Srek1ip1 T A 13: 104,973,981 (GRCm39) H129Q possibly damaging Het
Thumpd2 A T 17: 81,334,116 (GRCm39) C491S probably benign Het
Tle3 A T 9: 61,314,410 (GRCm39) N204I probably benign Het
Tmem131 A G 1: 36,862,167 (GRCm39) V677A probably benign Het
Topaz1 T G 9: 122,576,499 (GRCm39) L30R probably benign Het
Trim35 T A 14: 66,546,309 (GRCm39) C359S probably damaging Het
Ttn A C 2: 76,774,865 (GRCm39) V2105G unknown Het
Ube2o A G 11: 116,471,884 (GRCm39) V119A probably benign Het
Ubr2 A T 17: 47,279,308 (GRCm39) probably null Het
Uhmk1 A G 1: 170,032,757 (GRCm39) V347A possibly damaging Het
Utp4 C T 8: 107,649,497 (GRCm39) P649S probably damaging Het
Vmn2r28 G A 7: 5,483,818 (GRCm39) T794I probably damaging Het
Xpot C A 10: 121,458,848 (GRCm39) probably benign Het
Zfp729a C T 13: 67,768,294 (GRCm39) R645H probably benign Het
Other mutations in Vmn2r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r61 APN 7 41,950,175 (GRCm39) missense possibly damaging 0.96
IGL00824:Vmn2r61 APN 7 41,916,438 (GRCm39) missense probably benign 0.03
IGL00903:Vmn2r61 APN 7 41,949,935 (GRCm39) missense probably damaging 1.00
IGL01125:Vmn2r61 APN 7 41,909,550 (GRCm39) missense probably damaging 1.00
IGL01393:Vmn2r61 APN 7 41,916,258 (GRCm39) missense probably benign 0.08
IGL01712:Vmn2r61 APN 7 41,909,661 (GRCm39) missense probably damaging 0.98
IGL01822:Vmn2r61 APN 7 41,950,130 (GRCm39) missense probably benign 0.18
IGL01835:Vmn2r61 APN 7 41,950,015 (GRCm39) missense probably benign 0.12
IGL01844:Vmn2r61 APN 7 41,909,639 (GRCm39) missense probably benign 0.00
IGL01953:Vmn2r61 APN 7 41,949,613 (GRCm39) missense probably damaging 1.00
IGL02032:Vmn2r61 APN 7 41,949,466 (GRCm39) missense probably damaging 0.99
IGL02054:Vmn2r61 APN 7 41,926,158 (GRCm39) critical splice donor site probably null
IGL02569:Vmn2r61 APN 7 41,926,070 (GRCm39) missense probably damaging 1.00
IGL02697:Vmn2r61 APN 7 41,924,892 (GRCm39) missense possibly damaging 0.55
IGL02958:Vmn2r61 APN 7 41,949,361 (GRCm39) missense probably benign
IGL03290:Vmn2r61 APN 7 41,915,408 (GRCm39) missense probably benign 0.00
IGL03337:Vmn2r61 APN 7 41,916,509 (GRCm39) missense possibly damaging 0.58
IGL03369:Vmn2r61 APN 7 41,909,517 (GRCm39) missense probably benign
IGL03402:Vmn2r61 APN 7 41,909,679 (GRCm39) missense probably benign
R0026:Vmn2r61 UTSW 7 41,924,898 (GRCm39) missense possibly damaging 0.64
R0319:Vmn2r61 UTSW 7 41,949,941 (GRCm39) missense probably damaging 0.99
R0433:Vmn2r61 UTSW 7 41,915,335 (GRCm39) missense probably benign 0.02
R0555:Vmn2r61 UTSW 7 41,915,442 (GRCm39) missense probably benign 0.02
R0691:Vmn2r61 UTSW 7 41,949,844 (GRCm39) missense probably damaging 1.00
R1701:Vmn2r61 UTSW 7 41,949,935 (GRCm39) missense probably damaging 1.00
R1718:Vmn2r61 UTSW 7 41,950,121 (GRCm39) missense probably benign
R1835:Vmn2r61 UTSW 7 41,916,076 (GRCm39) nonsense probably null
R1920:Vmn2r61 UTSW 7 41,949,710 (GRCm39) missense possibly damaging 0.73
R2069:Vmn2r61 UTSW 7 41,949,425 (GRCm39) missense probably benign 0.06
R2326:Vmn2r61 UTSW 7 41,916,287 (GRCm39) missense probably damaging 1.00
R2402:Vmn2r61 UTSW 7 41,949,529 (GRCm39) missense possibly damaging 0.90
R3103:Vmn2r61 UTSW 7 41,916,067 (GRCm39) missense possibly damaging 0.73
R3107:Vmn2r61 UTSW 7 41,916,491 (GRCm39) missense possibly damaging 0.82
R4426:Vmn2r61 UTSW 7 41,950,159 (GRCm39) missense probably benign
R4426:Vmn2r61 UTSW 7 41,950,157 (GRCm39) missense probably benign
R4484:Vmn2r61 UTSW 7 41,950,120 (GRCm39) missense probably benign
R4748:Vmn2r61 UTSW 7 41,916,565 (GRCm39) missense probably damaging 0.96
R4835:Vmn2r61 UTSW 7 41,916,459 (GRCm39) missense possibly damaging 0.52
R4863:Vmn2r61 UTSW 7 41,950,132 (GRCm39) missense probably benign 0.03
R4923:Vmn2r61 UTSW 7 41,916,520 (GRCm39) missense probably damaging 1.00
R4968:Vmn2r61 UTSW 7 41,949,478 (GRCm39) missense probably benign 0.14
R5114:Vmn2r61 UTSW 7 41,949,953 (GRCm39) missense possibly damaging 0.92
R5297:Vmn2r61 UTSW 7 41,909,646 (GRCm39) missense probably benign
R5497:Vmn2r61 UTSW 7 41,924,906 (GRCm39) missense possibly damaging 0.95
R5508:Vmn2r61 UTSW 7 41,916,242 (GRCm39) missense possibly damaging 0.52
R5587:Vmn2r61 UTSW 7 41,949,911 (GRCm39) missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 41,949,917 (GRCm39) missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 41,916,677 (GRCm39) missense probably benign 0.00
R5782:Vmn2r61 UTSW 7 41,949,253 (GRCm39) missense probably damaging 1.00
R6136:Vmn2r61 UTSW 7 41,916,455 (GRCm39) missense probably damaging 1.00
R6207:Vmn2r61 UTSW 7 41,909,616 (GRCm39) missense probably benign 0.01
R6265:Vmn2r61 UTSW 7 41,915,915 (GRCm39) missense probably benign 0.01
R6272:Vmn2r61 UTSW 7 41,949,242 (GRCm39) missense probably damaging 1.00
R6355:Vmn2r61 UTSW 7 41,916,659 (GRCm39) missense probably benign 0.00
R6469:Vmn2r61 UTSW 7 41,915,283 (GRCm39) nonsense probably null
R6554:Vmn2r61 UTSW 7 41,926,139 (GRCm39) missense probably damaging 1.00
R6699:Vmn2r61 UTSW 7 41,949,580 (GRCm39) missense probably benign
R6768:Vmn2r61 UTSW 7 41,949,748 (GRCm39) missense probably damaging 1.00
R6824:Vmn2r61 UTSW 7 41,949,403 (GRCm39) missense probably benign 0.10
R6930:Vmn2r61 UTSW 7 41,949,364 (GRCm39) missense probably benign 0.02
R7053:Vmn2r61 UTSW 7 41,916,557 (GRCm39) missense probably damaging 0.96
R7238:Vmn2r61 UTSW 7 41,916,629 (GRCm39) missense possibly damaging 0.73
R7332:Vmn2r61 UTSW 7 41,909,534 (GRCm39) missense probably benign 0.00
R7359:Vmn2r61 UTSW 7 41,915,407 (GRCm39) missense probably benign 0.11
R7553:Vmn2r61 UTSW 7 41,916,205 (GRCm39) missense not run
R7710:Vmn2r61 UTSW 7 41,916,472 (GRCm39) missense probably damaging 1.00
R7732:Vmn2r61 UTSW 7 41,916,097 (GRCm39) missense probably benign
R7839:Vmn2r61 UTSW 7 41,916,032 (GRCm39) missense probably damaging 0.97
R8026:Vmn2r61 UTSW 7 41,916,141 (GRCm39) missense probably benign 0.02
R8440:Vmn2r61 UTSW 7 41,916,080 (GRCm39) missense probably benign 0.02
R8499:Vmn2r61 UTSW 7 41,949,700 (GRCm39) missense probably damaging 0.99
R8771:Vmn2r61 UTSW 7 41,916,194 (GRCm39) missense probably damaging 0.99
R8847:Vmn2r61 UTSW 7 41,950,010 (GRCm39) missense probably damaging 1.00
R8986:Vmn2r61 UTSW 7 41,915,325 (GRCm39) nonsense probably null
R9290:Vmn2r61 UTSW 7 41,915,385 (GRCm39) missense probably benign 0.27
R9311:Vmn2r61 UTSW 7 41,950,092 (GRCm39) missense possibly damaging 0.92
R9324:Vmn2r61 UTSW 7 41,916,619 (GRCm39) missense probably benign 0.00
R9476:Vmn2r61 UTSW 7 41,949,593 (GRCm39) missense probably damaging 1.00
R9521:Vmn2r61 UTSW 7 41,916,626 (GRCm39) missense probably damaging 0.99
R9619:Vmn2r61 UTSW 7 41,926,136 (GRCm39) missense probably damaging 0.98
R9729:Vmn2r61 UTSW 7 41,949,917 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r61 UTSW 7 41,949,388 (GRCm39) missense possibly damaging 0.93
Z1176:Vmn2r61 UTSW 7 41,916,166 (GRCm39) missense probably benign 0.00
Z1176:Vmn2r61 UTSW 7 41,909,585 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GAATCTGGATTCTAACATCTCCACC -3'
(R):5'- GTGTGTCTGATGTCAATACAGGAG -3'

Sequencing Primer
(F):5'- CCTTCATTGATCAAGATACTCAGGC -3'
(R):5'- GTAGCACTTGGGAGCAAA -3'
Posted On 2020-09-15