Incidental Mutation 'R7916:Utp4'
ID 648082
Institutional Source Beutler Lab
Gene Symbol Utp4
Ensembl Gene ENSMUSG00000041438
Gene Name UTP4 small subunit processome component
Synonyms Cirh1a, Tex292, TEG-292
MMRRC Submission 045964-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7916 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 107620268-107649720 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 107649497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 649 (P649S)
Ref Sequence ENSEMBL: ENSMUSP00000048377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047629]
AlphaFold Q8R2N2
Predicted Effect probably damaging
Transcript: ENSMUST00000047629
AA Change: P649S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048377
Gene: ENSMUSG00000041438
AA Change: P649S

DomainStartEndE-ValueType
WD40 5 44 6.19e-1 SMART
WD40 48 87 1.48e1 SMART
WD40 90 129 5.39e-5 SMART
WD40 134 172 1.48e-2 SMART
WD40 185 222 7.96e0 SMART
WD40 225 264 3.55e1 SMART
WD40 276 313 7.96e0 SMART
Blast:WD40 378 417 2e-19 BLAST
WD40 426 465 8.25e0 SMART
WD40 470 512 3.99e-1 SMART
WD40 515 554 2.22e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD40-repeat-containing protein that is localized to the nucleolus. Mutation of this gene causes North American Indian childhood cirrhosis, a severe intrahepatic cholestasis that results in transient neonatal jaundice, and progresses to periportal fibrosis and cirrhosis in childhood and adolescence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,682,454 (GRCm39) L195* probably null Het
Ahnak T G 19: 8,983,196 (GRCm39) D1493E possibly damaging Het
Alox12e C A 11: 70,212,111 (GRCm39) R162L probably benign Het
Bax T G 7: 45,115,539 (GRCm39) Q32P probably benign Het
Cand1 A G 10: 119,052,493 (GRCm39) M204T probably benign Het
Chd9 T A 8: 91,761,684 (GRCm39) Y2256* probably null Het
Chuk A G 19: 44,085,420 (GRCm39) I242T probably damaging Het
Cic T C 7: 24,987,715 (GRCm39) S1468P probably damaging Het
Col27a1 A G 4: 63,142,789 (GRCm39) H159R probably damaging Het
Cux1 T C 5: 136,311,815 (GRCm39) K1174E probably damaging Het
Dnah2 C A 11: 69,311,974 (GRCm39) probably null Het
Dpp3 C A 19: 4,967,052 (GRCm39) E351* probably null Het
Dyrk1a A G 16: 94,474,200 (GRCm39) Y319C probably damaging Het
E130308A19Rik T C 4: 59,719,841 (GRCm39) S458P probably damaging Het
Ehmt1 G A 2: 24,746,708 (GRCm39) L425F probably damaging Het
Emp2 C A 16: 10,102,437 (GRCm39) R125L possibly damaging Het
Farsb A G 1: 78,435,200 (GRCm39) probably null Het
Frk A T 10: 34,360,021 (GRCm39) R7S possibly damaging Het
Glb1l2 T C 9: 26,678,720 (GRCm39) T483A probably benign Het
Gm5773 T C 3: 93,680,586 (GRCm39) V86A possibly damaging Het
Gm7324 T G 14: 43,952,003 (GRCm39) D215E probably benign Het
Gng13 A T 17: 25,937,932 (GRCm39) K44* probably null Het
Gprin1 C T 13: 54,887,263 (GRCm39) G337D possibly damaging Het
Ighv1-84 G T 12: 115,944,609 (GRCm39) Q22K probably benign Het
Il20rb T C 9: 100,348,304 (GRCm39) H210R probably benign Het
Iqcm C T 8: 76,304,578 (GRCm39) S113L probably benign Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,712,417 (GRCm39) probably benign Het
Kmo G T 1: 175,487,236 (GRCm39) G430W probably damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Ldhd T G 8: 112,356,023 (GRCm39) D120A possibly damaging Het
Lyst T C 13: 13,821,657 (GRCm39) S1344P possibly damaging Het
Mb T A 15: 76,900,257 (GRCm39) I112F probably damaging Het
Mbd5 G A 2: 49,147,118 (GRCm39) V443M probably damaging Het
Milr1 A G 11: 106,654,688 (GRCm39) K180R possibly damaging Het
Mst1r T C 9: 107,784,777 (GRCm39) F145S probably damaging Het
Mthfd2 A T 6: 83,286,455 (GRCm39) I251K possibly damaging Het
Nfx1 T A 4: 40,977,142 (GRCm39) M272K probably benign Het
Nlrp3 A G 11: 59,442,689 (GRCm39) D747G probably benign Het
Odr4 C T 1: 150,260,249 (GRCm39) R123K probably benign Het
Or2y1 A T 11: 49,385,543 (GRCm39) Y61F probably benign Het
Or5p60 C A 7: 107,724,329 (GRCm39) S47I possibly damaging Het
Or8k18 A T 2: 86,085,202 (GRCm39) Y278* probably null Het
Pcdha11 A G 18: 37,140,441 (GRCm39) E690G probably benign Het
Pcdhga4 T A 18: 37,818,502 (GRCm39) I17N probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phf20 A G 2: 156,129,858 (GRCm39) K477E probably damaging Het
Pik3c2b T A 1: 133,028,642 (GRCm39) I1377N probably benign Het
Polr3h T C 15: 81,806,613 (GRCm39) K69E probably benign Het
Rpgrip1 A G 14: 52,368,641 (GRCm39) H280R possibly damaging Het
Rpp40 C A 13: 36,086,034 (GRCm39) R132L probably benign Het
Ryr1 G A 7: 28,790,364 (GRCm39) Q1488* probably null Het
Sh3bp1 A G 15: 78,791,421 (GRCm39) M403V probably benign Het
Slc20a1 G A 2: 129,049,757 (GRCm39) D340N probably benign Het
Snrnp200 T A 2: 127,074,979 (GRCm39) N1517K possibly damaging Het
Srek1ip1 T A 13: 104,973,981 (GRCm39) H129Q possibly damaging Het
Thumpd2 A T 17: 81,334,116 (GRCm39) C491S probably benign Het
Tle3 A T 9: 61,314,410 (GRCm39) N204I probably benign Het
Tmem131 A G 1: 36,862,167 (GRCm39) V677A probably benign Het
Topaz1 T G 9: 122,576,499 (GRCm39) L30R probably benign Het
Trim35 T A 14: 66,546,309 (GRCm39) C359S probably damaging Het
Ttn A C 2: 76,774,865 (GRCm39) V2105G unknown Het
Ube2o A G 11: 116,471,884 (GRCm39) V119A probably benign Het
Ubr2 A T 17: 47,279,308 (GRCm39) probably null Het
Uhmk1 A G 1: 170,032,757 (GRCm39) V347A possibly damaging Het
Vmn2r28 G A 7: 5,483,818 (GRCm39) T794I probably damaging Het
Vmn2r61 T G 7: 41,949,935 (GRCm39) F785C probably damaging Het
Xpot C A 10: 121,458,848 (GRCm39) probably benign Het
Zfp729a C T 13: 67,768,294 (GRCm39) R645H probably benign Het
Other mutations in Utp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Utp4 APN 8 107,621,330 (GRCm39) missense probably benign 0.02
IGL01871:Utp4 APN 8 107,638,949 (GRCm39) missense probably benign
IGL02100:Utp4 APN 8 107,624,807 (GRCm39) missense probably benign 0.00
IGL02501:Utp4 APN 8 107,632,873 (GRCm39) missense probably benign 0.16
IGL02948:Utp4 APN 8 107,621,273 (GRCm39) missense probably benign 0.31
IGL03210:Utp4 APN 8 107,642,888 (GRCm39) missense probably benign
Cheyenne_canon UTSW 8 107,638,907 (GRCm39) missense probably damaging 1.00
PIT4480001:Utp4 UTSW 8 107,632,817 (GRCm39) missense probably benign 0.00
R0066:Utp4 UTSW 8 107,649,530 (GRCm39) missense possibly damaging 0.70
R0066:Utp4 UTSW 8 107,649,530 (GRCm39) missense possibly damaging 0.70
R0145:Utp4 UTSW 8 107,621,301 (GRCm39) missense probably benign 0.02
R0158:Utp4 UTSW 8 107,640,018 (GRCm39) missense probably null
R0360:Utp4 UTSW 8 107,625,169 (GRCm39) unclassified probably benign
R0364:Utp4 UTSW 8 107,625,169 (GRCm39) unclassified probably benign
R0382:Utp4 UTSW 8 107,649,567 (GRCm39) missense probably benign 0.01
R0798:Utp4 UTSW 8 107,648,858 (GRCm39) missense probably benign 0.00
R1164:Utp4 UTSW 8 107,627,476 (GRCm39) critical splice acceptor site probably null
R1381:Utp4 UTSW 8 107,632,908 (GRCm39) missense probably benign 0.02
R1440:Utp4 UTSW 8 107,624,685 (GRCm39) unclassified probably benign
R1711:Utp4 UTSW 8 107,645,352 (GRCm39) missense probably damaging 1.00
R1839:Utp4 UTSW 8 107,640,086 (GRCm39) missense probably benign
R1903:Utp4 UTSW 8 107,638,982 (GRCm39) critical splice donor site probably null
R2060:Utp4 UTSW 8 107,625,153 (GRCm39) missense probably benign 0.33
R2938:Utp4 UTSW 8 107,649,561 (GRCm39) missense probably damaging 1.00
R5526:Utp4 UTSW 8 107,644,265 (GRCm39) missense possibly damaging 0.70
R5562:Utp4 UTSW 8 107,649,557 (GRCm39) missense probably benign 0.00
R5764:Utp4 UTSW 8 107,644,248 (GRCm39) missense possibly damaging 0.81
R5814:Utp4 UTSW 8 107,638,907 (GRCm39) missense probably damaging 1.00
R6310:Utp4 UTSW 8 107,645,253 (GRCm39) missense probably benign 0.16
R6478:Utp4 UTSW 8 107,631,078 (GRCm39) critical splice donor site probably null
R6523:Utp4 UTSW 8 107,625,095 (GRCm39) missense probably damaging 0.98
R7329:Utp4 UTSW 8 107,640,095 (GRCm39) missense probably benign 0.00
R8309:Utp4 UTSW 8 107,642,853 (GRCm39) missense probably benign 0.00
R9090:Utp4 UTSW 8 107,632,857 (GRCm39) missense probably damaging 1.00
R9147:Utp4 UTSW 8 107,621,310 (GRCm39) missense possibly damaging 0.93
R9271:Utp4 UTSW 8 107,632,857 (GRCm39) missense probably damaging 1.00
R9290:Utp4 UTSW 8 107,642,828 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TATGGTACCACGGCTGTCTG -3'
(R):5'- AATGACCTTCATGCCACTGC -3'

Sequencing Primer
(F):5'- GTCTGGCCCAGCTCAAGTTC -3'
(R):5'- AGGAAATCTGTGCTCATTCTTTTAG -3'
Posted On 2020-09-15