Incidental Mutation 'R7916:Kat6b'
ID648104
Institutional Source Beutler Lab
Gene Symbol Kat6b
Ensembl Gene ENSMUSG00000021767
Gene NameK(lysine) acetyltransferase 6B
SynonymsMyst4, monocytic leukemia, querkopf, B130044K16Rik, Morf, qkf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R7916 (G1)
Quality Score103.467
Status Not validated
Chromosome14
Chromosomal Location21481434-21672478 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGAGGAGGAGGAGGAGGAGGA to AGAGGAGGAGGAGGAGGA at 21662349 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069648] [ENSMUST00000112458] [ENSMUST00000182405] [ENSMUST00000182855] [ENSMUST00000182964]
Predicted Effect probably benign
Transcript: ENSMUST00000069648
SMART Domains Protein: ENSMUSP00000066693
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
low complexity region 386 398 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
Blast:PHD 483 573 3e-51 BLAST
Pfam:MOZ_SAS 594 772 4.5e-85 PFAM
coiled coil region 811 845 N/A INTRINSIC
coiled coil region 875 913 N/A INTRINSIC
low complexity region 926 943 N/A INTRINSIC
low complexity region 946 959 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1207 1237 N/A INTRINSIC
low complexity region 1391 1410 N/A INTRINSIC
low complexity region 1450 1464 N/A INTRINSIC
low complexity region 1490 1517 N/A INTRINSIC
low complexity region 1676 1695 N/A INTRINSIC
low complexity region 1811 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112458
SMART Domains Protein: ENSMUSP00000108077
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 159 3.4e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182405
SMART Domains Protein: ENSMUSP00000138377
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
Pfam:MOZ_SAS 482 669 1.3e-89 PFAM
coiled coil region 702 736 N/A INTRINSIC
coiled coil region 766 804 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 1044 1066 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1282 1301 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1381 1408 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 1702 1723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182855
SMART Domains Protein: ENSMUSP00000138511
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
Pfam:MOZ_SAS 482 669 1.3e-89 PFAM
coiled coil region 702 736 N/A INTRINSIC
coiled coil region 766 804 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 1044 1066 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1282 1301 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1381 1408 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 1702 1723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182964
SMART Domains Protein: ENSMUSP00000138421
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
low complexity region 386 398 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
Blast:PHD 483 573 3e-51 BLAST
Pfam:MOZ_SAS 591 778 1.4e-89 PFAM
coiled coil region 811 845 N/A INTRINSIC
coiled coil region 875 913 N/A INTRINSIC
low complexity region 926 943 N/A INTRINSIC
low complexity region 946 959 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1207 1237 N/A INTRINSIC
low complexity region 1391 1410 N/A INTRINSIC
low complexity region 1450 1464 N/A INTRINSIC
low complexity region 1490 1517 N/A INTRINSIC
low complexity region 1676 1695 N/A INTRINSIC
low complexity region 1811 1832 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Reduced expression of this gene results in developmental defects of the skeleton and brain, particularly the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,864,590 L195* probably null Het
Ahnak T G 19: 9,005,832 D1493E possibly damaging Het
Alox12e C A 11: 70,321,285 R162L probably benign Het
Bax T G 7: 45,466,115 Q32P probably benign Het
BC003331 C T 1: 150,384,498 R123K probably benign Het
Cand1 A G 10: 119,216,588 M204T probably benign Het
Chd9 T A 8: 91,035,056 Y2256* probably null Het
Chuk A G 19: 44,096,981 I242T probably damaging Het
Cic T C 7: 25,288,290 S1468P probably damaging Het
Col27a1 A G 4: 63,224,552 H159R probably damaging Het
Cux1 T C 5: 136,282,961 K1174E probably damaging Het
Dnah2 C A 11: 69,421,148 probably null Het
Dpp3 C A 19: 4,917,024 E351* probably null Het
Dyrk1a A G 16: 94,673,341 Y319C probably damaging Het
E130308A19Rik T C 4: 59,719,841 S458P probably damaging Het
Ehmt1 G A 2: 24,856,696 L425F probably damaging Het
Emp2 C A 16: 10,284,573 R125L possibly damaging Het
Farsb A G 1: 78,458,563 probably null Het
Frk A T 10: 34,484,025 R7S possibly damaging Het
Glb1l2 T C 9: 26,767,424 T483A probably benign Het
Gm5773 T C 3: 93,773,279 V86A possibly damaging Het
Gm7324 T G 14: 43,714,546 D215E probably benign Het
Gng13 A T 17: 25,718,958 K44* probably null Het
Gprin1 C T 13: 54,739,450 G337D possibly damaging Het
Ighv1-84 G T 12: 115,980,989 Q22K probably benign Het
Il20rb T C 9: 100,466,251 H210R probably benign Het
Iqcm C T 8: 75,577,950 S113L probably benign Het
Kmo G T 1: 175,659,670 G430W probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Ldhd T G 8: 111,629,391 D120A possibly damaging Het
Lyst T C 13: 13,647,072 S1344P possibly damaging Het
Mb T A 15: 77,016,057 I112F probably damaging Het
Mbd5 G A 2: 49,257,106 V443M probably damaging Het
Milr1 A G 11: 106,763,862 K180R possibly damaging Het
Mst1r T C 9: 107,907,578 F145S probably damaging Het
Mthfd2 A T 6: 83,309,473 I251K possibly damaging Het
Nfx1 T A 4: 40,977,142 M272K probably benign Het
Nlrp3 A G 11: 59,551,863 D747G probably benign Het
Olfr1049 A T 2: 86,254,858 Y278* probably null Het
Olfr1385 A T 11: 49,494,716 Y61F probably benign Het
Olfr484 C A 7: 108,125,122 S47I possibly damaging Het
Pcdha11 A G 18: 37,007,388 E690G probably benign Het
Pcdhga4 T A 18: 37,685,449 I17N probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf20 A G 2: 156,287,938 K477E probably damaging Het
Pik3c2b T A 1: 133,100,904 I1377N probably benign Het
Polr3h T C 15: 81,922,412 K69E probably benign Het
Rpgrip1 A G 14: 52,131,184 H280R possibly damaging Het
Rpp40 C A 13: 35,902,051 R132L probably benign Het
Ryr1 G A 7: 29,090,939 Q1488* probably null Het
Sh3bp1 A G 15: 78,907,221 M403V probably benign Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Snrnp200 T A 2: 127,233,059 N1517K possibly damaging Het
Srek1ip1 T A 13: 104,837,473 H129Q possibly damaging Het
Thumpd2 A T 17: 81,026,687 C491S probably benign Het
Tle3 A T 9: 61,407,128 N204I probably benign Het
Tmem131 A G 1: 36,823,086 V677A probably benign Het
Topaz1 T G 9: 122,747,434 L30R probably benign Het
Trim35 T A 14: 66,308,860 C359S probably damaging Het
Ttn A C 2: 76,944,521 V2105G unknown Het
Ube2o A G 11: 116,581,058 V119A probably benign Het
Ubr2 A T 17: 46,968,382 probably null Het
Uhmk1 A G 1: 170,205,188 V347A possibly damaging Het
Utp4 C T 8: 106,922,865 P649S probably damaging Het
Vmn2r28 G A 7: 5,480,819 T794I probably damaging Het
Vmn2r61 T G 7: 42,300,511 F785C probably damaging Het
Xpot C A 10: 121,622,943 probably benign Het
Zfp729a C T 13: 67,620,175 R645H probably benign Het
Other mutations in Kat6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kat6b APN 14 21668559 missense probably benign 0.00
IGL01128:Kat6b APN 14 21660860 missense probably benign
IGL02272:Kat6b APN 14 21626778 missense probably damaging 0.99
IGL02349:Kat6b APN 14 21637593 missense probably damaging 0.99
IGL02402:Kat6b APN 14 21631347 missense probably damaging 1.00
IGL02474:Kat6b APN 14 21669039 missense possibly damaging 0.95
IGL02516:Kat6b APN 14 21609868 splice site probably benign
IGL02666:Kat6b APN 14 21628870 missense probably damaging 1.00
IGL02971:Kat6b APN 14 21669758 missense probably damaging 1.00
IGL03075:Kat6b APN 14 21661570 nonsense probably null
IGL03274:Kat6b APN 14 21609763 missense possibly damaging 0.95
IGL03308:Kat6b APN 14 21624834 missense probably damaging 0.99
R0118:Kat6b UTSW 14 21669974 missense probably damaging 0.99
R0383:Kat6b UTSW 14 21669081 missense probably benign 0.02
R0441:Kat6b UTSW 14 21670233 missense probably damaging 1.00
R0457:Kat6b UTSW 14 21670530 missense probably damaging 0.96
R0558:Kat6b UTSW 14 21669421 missense probably benign 0.03
R0662:Kat6b UTSW 14 21662349 small deletion probably benign
R0684:Kat6b UTSW 14 21668781 missense probably benign
R0755:Kat6b UTSW 14 21637593 missense probably damaging 0.99
R1216:Kat6b UTSW 14 21622040 nonsense probably null
R1479:Kat6b UTSW 14 21618956 missense probably benign 0.19
R1873:Kat6b UTSW 14 21516989 missense probably damaging 1.00
R1957:Kat6b UTSW 14 21628879 missense probably damaging 1.00
R2151:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2152:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2153:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2154:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2399:Kat6b UTSW 14 21662349 small deletion probably benign
R3740:Kat6b UTSW 14 21670044 missense probably damaging 0.99
R3771:Kat6b UTSW 14 21517098 missense probably damaging 1.00
R4178:Kat6b UTSW 14 21618904 nonsense probably null
R4261:Kat6b UTSW 14 21669669 missense probably damaging 1.00
R4551:Kat6b UTSW 14 21661448 missense probably damaging 1.00
R4724:Kat6b UTSW 14 21660962 missense probably benign
R5055:Kat6b UTSW 14 21516994 missense probably damaging 0.99
R5098:Kat6b UTSW 14 21619015 splice site probably benign
R5121:Kat6b UTSW 14 21619258 missense probably damaging 0.98
R5158:Kat6b UTSW 14 21669986 missense possibly damaging 0.93
R5488:Kat6b UTSW 14 21669264 missense probably damaging 1.00
R5489:Kat6b UTSW 14 21669264 missense probably damaging 1.00
R5653:Kat6b UTSW 14 21669372 missense probably benign 0.10
R5742:Kat6b UTSW 14 21668435 missense probably damaging 0.99
R5868:Kat6b UTSW 14 21634479 missense probably damaging 1.00
R5969:Kat6b UTSW 14 21670792 missense probably damaging 0.97
R6110:Kat6b UTSW 14 21670487 missense probably damaging 1.00
R6427:Kat6b UTSW 14 21517412 missense probably benign 0.24
R6457:Kat6b UTSW 14 21670680 missense probably damaging 1.00
R6639:Kat6b UTSW 14 21517494 missense possibly damaging 0.57
R6891:Kat6b UTSW 14 21669036 missense probably benign 0.01
R7784:Kat6b UTSW 14 21660841 missense probably damaging 1.00
R7977:Kat6b UTSW 14 21669863 missense probably benign 0.00
R7987:Kat6b UTSW 14 21669863 missense probably benign 0.00
R8167:Kat6b UTSW 14 21669885 missense probably damaging 1.00
R8266:Kat6b UTSW 14 21516845 start gained probably benign
R8483:Kat6b UTSW 14 21669393 missense probably damaging 1.00
R8902:Kat6b UTSW 14 21669561 missense probably benign 0.30
R8909:Kat6b UTSW 14 21669146 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGCTGAACGACTAATGG -3'
(R):5'- CCACTGAGATGTAAACTACAGGG -3'

Sequencing Primer
(F):5'- TGGAACAAGCCAGCTGC -3'
(R):5'- TGAGATGTAAACTACAGGGAAACTAC -3'
Posted On2020-09-15