Incidental Mutation 'R7916:Rpgrip1'
ID648106
Institutional Source Beutler Lab
Gene Symbol Rpgrip1
Ensembl Gene ENSMUSG00000057132
Gene Nameretinitis pigmentosa GTPase regulator interacting protein 1
SynonymsA930002K18Rik, 4930505G06Rik, 4930401L23Rik, nmf247
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R7916 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location52110704-52163546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52131184 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 280 (H280R)
Ref Sequence ENSEMBL: ENSMUSP00000107230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181401]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111600
AA Change: H280R

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132
AA Change: H280R

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 542 N/A INTRINSIC
C2 602 707 1.08e-2 SMART
coiled coil region 746 795 N/A INTRINSIC
Blast:C2 958 1086 1e-37 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111603
AA Change: H280R

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132
AA Change: H280R

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 543 N/A INTRINSIC
Pfam:C2-C2_1 582 721 1.9e-49 PFAM
C2 764 869 7.3e-5 SMART
coiled coil region 910 999 N/A INTRINSIC
Blast:C2 1162 1290 2e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180646
SMART Domains Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 276 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000181401
AA Change: H280R

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132
AA Change: H280R

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 547 N/A INTRINSIC
Pfam:DUF3250 605 710 2.8e-46 PFAM
C2 753 858 1.08e-2 SMART
coiled coil region 899 988 N/A INTRINSIC
Blast:C2 1151 1279 1e-37 BLAST
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in photoreceptor cell dysmorphology. By 3 months of age mutant animals show near complete loss of photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,864,590 L195* probably null Het
Ahnak T G 19: 9,005,832 D1493E possibly damaging Het
Alox12e C A 11: 70,321,285 R162L probably benign Het
Bax T G 7: 45,466,115 Q32P probably benign Het
BC003331 C T 1: 150,384,498 R123K probably benign Het
Cand1 A G 10: 119,216,588 M204T probably benign Het
Chd9 T A 8: 91,035,056 Y2256* probably null Het
Chuk A G 19: 44,096,981 I242T probably damaging Het
Cic T C 7: 25,288,290 S1468P probably damaging Het
Col27a1 A G 4: 63,224,552 H159R probably damaging Het
Cux1 T C 5: 136,282,961 K1174E probably damaging Het
Dnah2 C A 11: 69,421,148 probably null Het
Dpp3 C A 19: 4,917,024 E351* probably null Het
Dyrk1a A G 16: 94,673,341 Y319C probably damaging Het
E130308A19Rik T C 4: 59,719,841 S458P probably damaging Het
Ehmt1 G A 2: 24,856,696 L425F probably damaging Het
Emp2 C A 16: 10,284,573 R125L possibly damaging Het
Farsb A G 1: 78,458,563 probably null Het
Frk A T 10: 34,484,025 R7S possibly damaging Het
Glb1l2 T C 9: 26,767,424 T483A probably benign Het
Gm5773 T C 3: 93,773,279 V86A possibly damaging Het
Gm7324 T G 14: 43,714,546 D215E probably benign Het
Gng13 A T 17: 25,718,958 K44* probably null Het
Gprin1 C T 13: 54,739,450 G337D possibly damaging Het
Ighv1-84 G T 12: 115,980,989 Q22K probably benign Het
Il20rb T C 9: 100,466,251 H210R probably benign Het
Iqcm C T 8: 75,577,950 S113L probably benign Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kmo G T 1: 175,659,670 G430W probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Ldhd T G 8: 111,629,391 D120A possibly damaging Het
Lyst T C 13: 13,647,072 S1344P possibly damaging Het
Mb T A 15: 77,016,057 I112F probably damaging Het
Mbd5 G A 2: 49,257,106 V443M probably damaging Het
Milr1 A G 11: 106,763,862 K180R possibly damaging Het
Mst1r T C 9: 107,907,578 F145S probably damaging Het
Mthfd2 A T 6: 83,309,473 I251K possibly damaging Het
Nfx1 T A 4: 40,977,142 M272K probably benign Het
Nlrp3 A G 11: 59,551,863 D747G probably benign Het
Olfr1049 A T 2: 86,254,858 Y278* probably null Het
Olfr1385 A T 11: 49,494,716 Y61F probably benign Het
Olfr484 C A 7: 108,125,122 S47I possibly damaging Het
Pcdha11 A G 18: 37,007,388 E690G probably benign Het
Pcdhga4 T A 18: 37,685,449 I17N probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf20 A G 2: 156,287,938 K477E probably damaging Het
Pik3c2b T A 1: 133,100,904 I1377N probably benign Het
Polr3h T C 15: 81,922,412 K69E probably benign Het
Rpp40 C A 13: 35,902,051 R132L probably benign Het
Ryr1 G A 7: 29,090,939 Q1488* probably null Het
Sh3bp1 A G 15: 78,907,221 M403V probably benign Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Snrnp200 T A 2: 127,233,059 N1517K possibly damaging Het
Srek1ip1 T A 13: 104,837,473 H129Q possibly damaging Het
Thumpd2 A T 17: 81,026,687 C491S probably benign Het
Tle3 A T 9: 61,407,128 N204I probably benign Het
Tmem131 A G 1: 36,823,086 V677A probably benign Het
Topaz1 T G 9: 122,747,434 L30R probably benign Het
Trim35 T A 14: 66,308,860 C359S probably damaging Het
Ttn A C 2: 76,944,521 V2105G unknown Het
Ube2o A G 11: 116,581,058 V119A probably benign Het
Ubr2 A T 17: 46,968,382 probably null Het
Uhmk1 A G 1: 170,205,188 V347A possibly damaging Het
Utp4 C T 8: 106,922,865 P649S probably damaging Het
Vmn2r28 G A 7: 5,480,819 T794I probably damaging Het
Vmn2r61 T G 7: 42,300,511 F785C probably damaging Het
Xpot C A 10: 121,622,943 probably benign Het
Zfp729a C T 13: 67,620,175 R645H probably benign Het
Other mutations in Rpgrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Rpgrip1 APN 14 52150438 splice site probably null
IGL01016:Rpgrip1 APN 14 52145836 missense probably damaging 1.00
IGL01019:Rpgrip1 APN 14 52131176 missense possibly damaging 0.70
IGL01382:Rpgrip1 APN 14 52145477 missense possibly damaging 0.93
IGL01433:Rpgrip1 APN 14 52126377 missense probably damaging 1.00
IGL01528:Rpgrip1 APN 14 52112177 nonsense probably null
IGL01548:Rpgrip1 APN 14 52126271 splice site probably benign
IGL01652:Rpgrip1 APN 14 52145492 unclassified probably benign
IGL02040:Rpgrip1 APN 14 52121019 missense possibly damaging 0.86
IGL02113:Rpgrip1 APN 14 52133844 missense possibly damaging 0.85
IGL02121:Rpgrip1 APN 14 52147374 missense possibly damaging 0.89
IGL02185:Rpgrip1 APN 14 52112228 missense possibly damaging 0.72
IGL02234:Rpgrip1 APN 14 52131309 splice site probably benign
IGL02322:Rpgrip1 APN 14 52150042 missense possibly damaging 0.89
IGL02379:Rpgrip1 APN 14 52138888 missense possibly damaging 0.53
IGL02524:Rpgrip1 APN 14 52121054 missense probably benign 0.01
IGL02836:Rpgrip1 APN 14 52145257 splice site probably null
IGL03264:Rpgrip1 APN 14 52140652 missense possibly damaging 0.53
IGL03410:Rpgrip1 APN 14 52158366 unclassified probably benign
FR4976:Rpgrip1 UTSW 14 52149394 utr 3 prime probably benign
FR4976:Rpgrip1 UTSW 14 52149544 utr 3 prime probably benign
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0089:Rpgrip1 UTSW 14 52149384 utr 3 prime probably benign
R0498:Rpgrip1 UTSW 14 52131314 splice site probably benign
R0602:Rpgrip1 UTSW 14 52133856 missense possibly damaging 0.72
R0776:Rpgrip1 UTSW 14 52141169 missense possibly damaging 0.85
R1139:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
R1528:Rpgrip1 UTSW 14 52112224 missense probably benign 0.01
R1715:Rpgrip1 UTSW 14 52140691 missense possibly damaging 0.53
R1934:Rpgrip1 UTSW 14 52114644 missense possibly damaging 0.53
R2087:Rpgrip1 UTSW 14 52136622 splice site probably null
R2114:Rpgrip1 UTSW 14 52149567 missense probably benign 0.27
R3406:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R3835:Rpgrip1 UTSW 14 52147253 missense probably damaging 1.00
R4084:Rpgrip1 UTSW 14 52149351 missense possibly damaging 0.72
R4124:Rpgrip1 UTSW 14 52152324 splice site probably null
R4381:Rpgrip1 UTSW 14 52150449 missense possibly damaging 0.54
R4407:Rpgrip1 UTSW 14 52147399 missense probably damaging 1.00
R4520:Rpgrip1 UTSW 14 52152289 missense probably benign 0.08
R4904:Rpgrip1 UTSW 14 52121087 missense possibly damaging 0.86
R4904:Rpgrip1 UTSW 14 52160129 missense probably damaging 0.97
R5284:Rpgrip1 UTSW 14 52149276 missense probably damaging 1.00
R5342:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R5377:Rpgrip1 UTSW 14 52160195 missense possibly damaging 0.96
R5499:Rpgrip1 UTSW 14 52140585 missense probably benign 0.00
R5729:Rpgrip1 UTSW 14 52160160 missense probably benign 0.28
R5834:Rpgrip1 UTSW 14 52158382 missense probably damaging 0.99
R6157:Rpgrip1 UTSW 14 52112174 missense probably benign 0.00
R6455:Rpgrip1 UTSW 14 52141189 missense probably damaging 0.97
R6796:Rpgrip1 UTSW 14 52150012 missense probably damaging 1.00
R7065:Rpgrip1 UTSW 14 52141193 missense possibly damaging 0.96
R7173:Rpgrip1 UTSW 14 52112176 missense possibly damaging 0.59
R7302:Rpgrip1 UTSW 14 52149555 missense unknown
R7315:Rpgrip1 UTSW 14 52121001 missense not run
R7320:Rpgrip1 UTSW 14 52131216 missense possibly damaging 0.53
R7344:Rpgrip1 UTSW 14 52140659 missense probably damaging 0.98
R7459:Rpgrip1 UTSW 14 52140559 missense probably benign 0.18
R7797:Rpgrip1 UTSW 14 52133820 missense possibly damaging 0.53
R7852:Rpgrip1 UTSW 14 52145880 missense probably benign 0.01
R7990:Rpgrip1 UTSW 14 52129518 missense possibly damaging 0.53
R8041:Rpgrip1 UTSW 14 52119245 missense possibly damaging 0.53
R8344:Rpgrip1 UTSW 14 52150362 missense possibly damaging 0.62
R8403:Rpgrip1 UTSW 14 52152201 critical splice acceptor site probably null
R8559:Rpgrip1 UTSW 14 52149257 missense unknown
R8679:Rpgrip1 UTSW 14 52159395 missense probably damaging 1.00
R8817:Rpgrip1 UTSW 14 52140599 missense probably benign 0.33
RF028:Rpgrip1 UTSW 14 52149398 nonsense probably null
RF034:Rpgrip1 UTSW 14 52149526 utr 3 prime probably benign
RF035:Rpgrip1 UTSW 14 52149393 utr 3 prime probably benign
RF036:Rpgrip1 UTSW 14 52149541 frame shift probably null
RF040:Rpgrip1 UTSW 14 52149537 frame shift probably null
RF043:Rpgrip1 UTSW 14 52149395 utr 3 prime probably benign
X0024:Rpgrip1 UTSW 14 52141208 missense possibly damaging 0.85
X0026:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACTGTATTGTTCATTATCTTCAAGGTC -3'
(R):5'- TTCACCCGAGCCTGGACTA -3'

Sequencing Primer
(F):5'- GTTGAGAGTTCTACCTACAGATGCC -3'
(R):5'- AGGACACAGTTGATAGTGTCTTCTC -3'
Posted On2020-09-15