Incidental Mutation 'R0022:Ppp1ca'
ID64812
Institutional Source Beutler Lab
Gene Symbol Ppp1ca
Ensembl Gene ENSMUSG00000040385
Gene Nameprotein phosphatase 1, catalytic subunit, alpha isoform
Synonymsdism2, Ppp1c
MMRRC Submission 038317-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R0022 (G1)
Quality Score180
Status Validated
Chromosome19
Chromosomal Location4192158-4195419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4194581 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 213 (V213G)
Ref Sequence ENSEMBL: ENSMUSP00000039109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025740] [ENSMUST00000045864] [ENSMUST00000046094]
Predicted Effect probably benign
Transcript: ENSMUST00000025740
SMART Domains Protein: ENSMUSP00000025740
Gene: ENSMUSG00000024824

DomainStartEndE-ValueType
Pfam:Rad9 13 265 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045864
SMART Domains Protein: ENSMUSP00000042660
Gene: ENSMUSG00000040247

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
TBC 87 301 7.1e-61 SMART
low complexity region 393 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000046094
AA Change: V213G

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039109
Gene: ENSMUSG00000040385
AA Change: V213G

DomainStartEndE-ValueType
PP2Ac 30 300 1.4e-164 SMART
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies in both human and mice suggest that PP1 is an important regulator of cardiac function. Mouse studies also suggest that PP1 functions as a suppressor of learning and memory. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,628,245 R240Q probably damaging Het
2310035C23Rik T A 1: 105,691,902 probably benign Het
Agl A T 3: 116,793,836 probably null Het
Arhgap29 G A 3: 121,988,937 V91I possibly damaging Het
Aste1 T A 9: 105,396,624 L21* probably null Het
Bpifb5 A T 2: 154,230,348 D325V probably damaging Het
Btbd10 G A 7: 113,325,781 Q287* probably null Het
Cdc20 T A 4: 118,435,489 H354L probably damaging Het
Cdhr3 G A 12: 33,082,264 T120I probably damaging Het
Col5a2 G A 1: 45,383,683 R1125* probably null Het
Col9a3 A G 2: 180,619,756 D613G probably damaging Het
Coro7 C T 16: 4,633,304 R507H probably benign Het
Crebbp A T 16: 4,085,228 V2049E probably damaging Het
Cryga T C 1: 65,103,223 I4V probably damaging Het
D930020B18Rik A G 10: 121,671,770 T138A probably damaging Het
Dclre1b G T 3: 103,803,148 H482Q probably benign Het
Dpy19l2 A G 9: 24,696,124 S14P probably benign Het
Elavl3 C A 9: 22,036,871 probably benign Het
Ephb6 T C 6: 41,614,569 V220A probably damaging Het
Exoc7 A T 11: 116,297,582 I297N possibly damaging Het
Gdpd4 A T 7: 97,982,875 N332Y probably damaging Het
Ggct C A 6: 54,985,902 E175* probably null Het
Gm5316 T C 6: 122,900,395 noncoding transcript Het
Hoxa7 T C 6: 52,217,383 N8S probably damaging Het
Ifi208 A G 1: 173,683,046 T256A possibly damaging Het
Il12rb2 A G 6: 67,298,919 F630S probably damaging Het
Kit A G 5: 75,622,997 N378S probably benign Het
Lmntd1 T A 6: 145,429,990 Y74F probably benign Het
Lrp1b A T 2: 40,998,038 probably benign Het
Ltbp1 T A 17: 75,364,360 V1194D probably damaging Het
Mc5r T G 18: 68,338,782 S71A probably benign Het
Mcm7 T C 5: 138,164,719 *390W probably null Het
Myo18a T C 11: 77,843,233 probably null Het
Naa25 C A 5: 121,417,976 L276M probably damaging Het
Nlrp1a T G 11: 71,123,381 T348P probably damaging Het
Nlrp1b T G 11: 71,161,929 K888T possibly damaging Het
Olfr1276 A G 2: 111,257,649 Y178C probably benign Het
Pabpc6 A T 17: 9,669,216 N135K probably benign Het
Pdzd2 G A 15: 12,371,605 A2568V possibly damaging Het
Pik3r2 A G 8: 70,770,901 F346S probably damaging Het
Pkd1 T C 17: 24,594,819 W4086R probably damaging Het
Plekhb2 G A 1: 34,866,239 probably benign Het
Plxnb2 A G 15: 89,163,276 probably null Het
Pmfbp1 C T 8: 109,525,407 R395W probably damaging Het
Pnldc1 A G 17: 12,890,119 Y497H probably damaging Het
Rapgef2 G A 3: 79,087,900 R814C probably damaging Het
Rnasel A T 1: 153,760,775 I634F probably damaging Het
Rnf157 A T 11: 116,349,450 probably benign Het
Ryr3 A G 2: 112,640,666 S4567P probably damaging Het
Smcr8 T A 11: 60,780,359 W778R probably damaging Het
Stat1 T A 1: 52,140,630 L333Q probably damaging Het
Strc A G 2: 121,368,393 L1391P probably damaging Het
Tek G A 4: 94,837,272 V592M probably damaging Het
Top1 A C 2: 160,702,799 K278N possibly damaging Het
Utrn C T 10: 12,709,956 probably benign Het
Wdr7 T C 18: 63,777,634 I699T probably damaging Het
Zfp30 A G 7: 29,792,435 E119G possibly damaging Het
Other mutations in Ppp1ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Ppp1ca APN 19 4193144 missense probably benign 0.25
IGL00834:Ppp1ca APN 19 4194520 missense probably benign 0.20
IGL01017:Ppp1ca APN 19 4193111 missense probably damaging 0.96
IGL02150:Ppp1ca APN 19 4194699 splice site probably benign
IGL02295:Ppp1ca APN 19 4194482 nonsense probably null
R0022:Ppp1ca UTSW 19 4194581 missense possibly damaging 0.51
R2680:Ppp1ca UTSW 19 4194595 missense possibly damaging 0.81
R3978:Ppp1ca UTSW 19 4192254 missense probably benign 0.05
R4514:Ppp1ca UTSW 19 4195055 missense probably benign
R5131:Ppp1ca UTSW 19 4194896 missense probably damaging 1.00
R7606:Ppp1ca UTSW 19 4193089 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCACAGGACAGCACTTGGTTTAAGG -3'
(R):5'- TGGCACCAGCATTGTCAAACTCTC -3'

Sequencing Primer
(F):5'- CAGCACTTGGTTTAAGGAACAC -3'
(R):5'- GTCAAACTCTCCACAGTAGTTGG -3'
Posted On2013-08-06