Incidental Mutation 'R7917:Olfr1308'
ID648126
Institutional Source Beutler Lab
Gene Symbol Olfr1308
Ensembl Gene ENSMUSG00000074952
Gene Nameolfactory receptor 1308
SynonymsMOR245-22, GA_x6K02T2Q125-73008844-73007882
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7917 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111959285-111964944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 111960965 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 36 (V36G)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
Predicted Effect probably damaging
Transcript: ENSMUST00000099605
AA Change: V36G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: V36G

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207560
AA Change: V36G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 110,068,107 H730Q probably damaging Het
Adam20 A G 8: 40,796,371 D506G probably damaging Het
Brinp1 A G 4: 68,904,953 M1T probably null Het
Ccnc T A 4: 21,748,158 N273K possibly damaging Het
Cfdp1 C A 8: 111,840,401 V159L possibly damaging Het
Cyb5r1 T A 1: 134,406,900 probably benign Het
Dsp C T 13: 38,167,639 Q145* probably null Het
Exosc9 G A 3: 36,553,819 V59I probably damaging Het
Fermt2 C G 14: 45,461,861 R592T probably damaging Het
Fryl A G 5: 73,054,532 S2381P probably damaging Het
Fscn2 G A 11: 120,367,256 E335K possibly damaging Het
Hapln1 T C 13: 89,607,878 I267T probably benign Het
Hdac9 T A 12: 34,433,210 I93L probably benign Het
Igfn1 T C 1: 135,971,968 D535G probably damaging Het
Ighv1-4 A T 12: 114,487,545 F9I possibly damaging Het
Il3ra T A 14: 14,350,773 H262Q possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mtg1 A T 7: 140,147,265 D227V probably damaging Het
Nrcam T G 12: 44,573,763 probably null Het
Olfr309 T C 7: 86,306,478 T212A probably damaging Het
Olfr906 T A 9: 38,488,609 Y193* probably null Het
Pcdha1 T A 18: 36,932,201 D639E possibly damaging Het
Pcdhga8 T A 18: 37,727,616 V575E possibly damaging Het
Pcif1 G T 2: 164,888,472 R375L probably benign Het
Pcna A T 2: 132,253,009 S10T probably benign Het
Pdzd8 A G 19: 59,345,086 S168P probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polq T A 16: 37,065,288 D1842E probably benign Het
Rag2 A T 2: 101,629,695 N117Y probably damaging Het
Scnn1g T C 7: 121,743,693 Y290H probably damaging Het
Sri T C 5: 8,063,409 probably null Het
Tek T C 4: 94,820,135 V361A possibly damaging Het
Terf1 T A 1: 15,819,076 L243Q probably damaging Het
Thrap3 G A 4: 126,175,420 T646I probably damaging Het
Uba1y A G Y: 821,274 I86V probably benign Het
Vmn2r29 A G 7: 7,231,728 S720P probably damaging Het
Zeb2 T C 2: 44,996,409 N879D possibly damaging Het
Zfp266 T C 9: 20,505,127 T56A probably benign Het
Zxdc T A 6: 90,382,009 I541N probably damaging Het
Other mutations in Olfr1308
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Olfr1308 APN 2 111960275 missense possibly damaging 0.84
IGL01359:Olfr1308 APN 2 111961061 missense probably benign
IGL01731:Olfr1308 APN 2 111960635 missense probably benign 0.03
IGL01788:Olfr1308 APN 2 111961007 missense probably benign
IGL02385:Olfr1308 APN 2 111960258 missense probably benign 0.00
IGL02969:Olfr1308 APN 2 111960567 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0244:Olfr1308 UTSW 2 111961016 missense probably benign 0.13
R0265:Olfr1308 UTSW 2 111960494 missense probably damaging 0.99
R1268:Olfr1308 UTSW 2 111960877 missense possibly damaging 0.78
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1568:Olfr1308 UTSW 2 111960240 missense probably benign 0.02
R2401:Olfr1308 UTSW 2 111960149 missense probably benign 0.01
R4396:Olfr1308 UTSW 2 111960215 missense probably damaging 1.00
R4528:Olfr1308 UTSW 2 111960948 missense probably damaging 1.00
R5916:Olfr1308 UTSW 2 111960830 missense probably damaging 1.00
R6332:Olfr1308 UTSW 2 111960746 missense probably damaging 0.98
R6595:Olfr1308 UTSW 2 111960170 missense possibly damaging 0.95
R7339:Olfr1308 UTSW 2 111960611 missense probably benign 0.12
R8017:Olfr1308 UTSW 2 111960573 missense probably damaging 0.99
R8092:Olfr1308 UTSW 2 111960307 missense probably benign 0.00
R8246:Olfr1308 UTSW 2 111960138 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAAGATTTGAGTGACACAACCTC -3'
(R):5'- GCCTCACAACTTGAAGATTCTC -3'

Sequencing Primer
(F):5'- TTGAGTGACACAACCTCTAAAAGAG -3'
(R):5'- CTCACAACTTGAAGATTCTCCTATTC -3'
Posted On2020-09-15