Incidental Mutation 'R7917:Or4f57'
ID 648126
Institutional Source Beutler Lab
Gene Symbol Or4f57
Ensembl Gene ENSMUSG00000074952
Gene Name olfactory receptor family 4 subfamily F member 57
Synonyms MOR245-22, Olfr1308, GA_x6K02T2Q125-73008844-73007882
MMRRC Submission 045965-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7917 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111790454-111791416 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 111791310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 36 (V36G)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
AlphaFold Q7TQX0
Predicted Effect probably damaging
Transcript: ENSMUST00000099605
AA Change: V36G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: V36G

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207560
AA Change: V36G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 109,958,933 (GRCm39) H730Q probably damaging Het
Adam20 A G 8: 41,249,408 (GRCm39) D506G probably damaging Het
Brinp1 A G 4: 68,823,190 (GRCm39) M1T probably null Het
Ccnc T A 4: 21,748,158 (GRCm39) N273K possibly damaging Het
Cfdp1 C A 8: 112,567,033 (GRCm39) V159L possibly damaging Het
Cyb5r1 T A 1: 134,334,638 (GRCm39) probably benign Het
Dsp C T 13: 38,351,615 (GRCm39) Q145* probably null Het
Exosc9 G A 3: 36,607,968 (GRCm39) V59I probably damaging Het
Fermt2 C G 14: 45,699,318 (GRCm39) R592T probably damaging Het
Fryl A G 5: 73,211,875 (GRCm39) S2381P probably damaging Het
Fscn2 G A 11: 120,258,082 (GRCm39) E335K possibly damaging Het
Hapln1 T C 13: 89,755,997 (GRCm39) I267T probably benign Het
Hdac9 T A 12: 34,483,209 (GRCm39) I93L probably benign Het
Igfn1 T C 1: 135,899,706 (GRCm39) D535G probably damaging Het
Ighv1-4 A T 12: 114,451,165 (GRCm39) F9I possibly damaging Het
Il3ra T A 14: 14,350,773 (GRCm38) H262Q possibly damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Mtg1 A T 7: 139,727,178 (GRCm39) D227V probably damaging Het
Nrcam T G 12: 44,620,546 (GRCm39) probably null Het
Or13g1 T C 7: 85,955,686 (GRCm39) T212A probably damaging Het
Or8b1 T A 9: 38,399,905 (GRCm39) Y193* probably null Het
Pcdha1 T A 18: 37,065,254 (GRCm39) D639E possibly damaging Het
Pcdhga8 T A 18: 37,860,669 (GRCm39) V575E possibly damaging Het
Pcif1 G T 2: 164,730,392 (GRCm39) R375L probably benign Het
Pcna A T 2: 132,094,929 (GRCm39) S10T probably benign Het
Pdzd8 A G 19: 59,333,518 (GRCm39) S168P probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Polq T A 16: 36,885,650 (GRCm39) D1842E probably benign Het
Rag2 A T 2: 101,460,040 (GRCm39) N117Y probably damaging Het
Scnn1g T C 7: 121,342,916 (GRCm39) Y290H probably damaging Het
Sri T C 5: 8,113,409 (GRCm39) probably null Het
Tek T C 4: 94,708,372 (GRCm39) V361A possibly damaging Het
Terf1 T A 1: 15,889,300 (GRCm39) L243Q probably damaging Het
Thrap3 G A 4: 126,069,213 (GRCm39) T646I probably damaging Het
Uba1y A G Y: 821,274 (GRCm39) I86V probably benign Het
Vmn2r29 A G 7: 7,234,727 (GRCm39) S720P probably damaging Het
Zeb2 T C 2: 44,886,421 (GRCm39) N879D possibly damaging Het
Zfp266 T C 9: 20,416,423 (GRCm39) T56A probably benign Het
Zxdc T A 6: 90,358,991 (GRCm39) I541N probably damaging Het
Other mutations in Or4f57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Or4f57 APN 2 111,790,620 (GRCm39) missense possibly damaging 0.84
IGL01359:Or4f57 APN 2 111,791,406 (GRCm39) missense probably benign
IGL01731:Or4f57 APN 2 111,790,980 (GRCm39) missense probably benign 0.03
IGL01788:Or4f57 APN 2 111,791,352 (GRCm39) missense probably benign
IGL02385:Or4f57 APN 2 111,790,603 (GRCm39) missense probably benign 0.00
IGL02969:Or4f57 APN 2 111,790,912 (GRCm39) missense probably damaging 1.00
R0102:Or4f57 UTSW 2 111,790,942 (GRCm39) missense probably damaging 1.00
R0102:Or4f57 UTSW 2 111,790,942 (GRCm39) missense probably damaging 1.00
R0244:Or4f57 UTSW 2 111,791,361 (GRCm39) missense probably benign 0.13
R0265:Or4f57 UTSW 2 111,790,839 (GRCm39) missense probably damaging 0.99
R1268:Or4f57 UTSW 2 111,791,222 (GRCm39) missense possibly damaging 0.78
R1406:Or4f57 UTSW 2 111,790,926 (GRCm39) missense probably benign 0.07
R1406:Or4f57 UTSW 2 111,790,926 (GRCm39) missense probably benign 0.07
R1568:Or4f57 UTSW 2 111,790,585 (GRCm39) missense probably benign 0.02
R2401:Or4f57 UTSW 2 111,790,494 (GRCm39) missense probably benign 0.01
R4396:Or4f57 UTSW 2 111,790,560 (GRCm39) missense probably damaging 1.00
R4528:Or4f57 UTSW 2 111,791,293 (GRCm39) missense probably damaging 1.00
R5916:Or4f57 UTSW 2 111,791,175 (GRCm39) missense probably damaging 1.00
R6332:Or4f57 UTSW 2 111,791,091 (GRCm39) missense probably damaging 0.98
R6595:Or4f57 UTSW 2 111,790,515 (GRCm39) missense possibly damaging 0.95
R7339:Or4f57 UTSW 2 111,790,956 (GRCm39) missense probably benign 0.12
R8017:Or4f57 UTSW 2 111,790,918 (GRCm39) missense probably damaging 0.99
R8092:Or4f57 UTSW 2 111,790,652 (GRCm39) missense probably benign 0.00
R8246:Or4f57 UTSW 2 111,790,483 (GRCm39) missense probably benign 0.05
R9389:Or4f57 UTSW 2 111,790,872 (GRCm39) missense probably damaging 1.00
R9515:Or4f57 UTSW 2 111,790,584 (GRCm39) missense possibly damaging 0.54
R9631:Or4f57 UTSW 2 111,791,377 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAAGATTTGAGTGACACAACCTC -3'
(R):5'- GCCTCACAACTTGAAGATTCTC -3'

Sequencing Primer
(F):5'- TTGAGTGACACAACCTCTAAAAGAG -3'
(R):5'- CTCACAACTTGAAGATTCTCCTATTC -3'
Posted On 2020-09-15