Incidental Mutation 'R7917:Sri'
ID648136
Institutional Source Beutler Lab
Gene Symbol Sri
Ensembl Gene ENSMUSG00000003161
Gene Namesorcin
SynonymsSor, 2210417O06Rik, 2900070H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R7917 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location8046078-8069379 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 8063409 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088786] [ENSMUST00000148633]
Predicted Effect probably null
Transcript: ENSMUST00000088786
SMART Domains Protein: ENSMUSP00000086165
Gene: ENSMUSG00000003161

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EF-hand_5 30 43 8.7e-4 PFAM
EFh 59 87 6.75e0 SMART
EFh 89 117 1.02e-2 SMART
Blast:EFh 153 183 9e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000148633
SMART Domains Protein: ENSMUSP00000118221
Gene: ENSMUSG00000003161

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:EF-hand_5 45 58 9.6e-4 PFAM
EFh 74 102 6.75e0 SMART
EFh 104 132 1.02e-2 SMART
Blast:EFh 168 198 1e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 110,068,107 H730Q probably damaging Het
Adam20 A G 8: 40,796,371 D506G probably damaging Het
Brinp1 A G 4: 68,904,953 M1T probably null Het
Ccnc T A 4: 21,748,158 N273K possibly damaging Het
Cfdp1 C A 8: 111,840,401 V159L possibly damaging Het
Cyb5r1 T A 1: 134,406,900 probably benign Het
Dsp C T 13: 38,167,639 Q145* probably null Het
Exosc9 G A 3: 36,553,819 V59I probably damaging Het
Fermt2 C G 14: 45,461,861 R592T probably damaging Het
Fryl A G 5: 73,054,532 S2381P probably damaging Het
Fscn2 G A 11: 120,367,256 E335K possibly damaging Het
Hapln1 T C 13: 89,607,878 I267T probably benign Het
Hdac9 T A 12: 34,433,210 I93L probably benign Het
Igfn1 T C 1: 135,971,968 D535G probably damaging Het
Ighv1-4 A T 12: 114,487,545 F9I possibly damaging Het
Il3ra T A 14: 14,350,773 H262Q possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mtg1 A T 7: 140,147,265 D227V probably damaging Het
Nrcam T G 12: 44,573,763 probably null Het
Olfr1308 A C 2: 111,960,965 V36G probably damaging Het
Olfr309 T C 7: 86,306,478 T212A probably damaging Het
Olfr906 T A 9: 38,488,609 Y193* probably null Het
Pcdha1 T A 18: 36,932,201 D639E possibly damaging Het
Pcdhga8 T A 18: 37,727,616 V575E possibly damaging Het
Pcif1 G T 2: 164,888,472 R375L probably benign Het
Pcna A T 2: 132,253,009 S10T probably benign Het
Pdzd8 A G 19: 59,345,086 S168P probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polq T A 16: 37,065,288 D1842E probably benign Het
Rag2 A T 2: 101,629,695 N117Y probably damaging Het
Scnn1g T C 7: 121,743,693 Y290H probably damaging Het
Tek T C 4: 94,820,135 V361A possibly damaging Het
Terf1 T A 1: 15,819,076 L243Q probably damaging Het
Thrap3 G A 4: 126,175,420 T646I probably damaging Het
Uba1y A G Y: 821,274 I86V probably benign Het
Vmn2r29 A G 7: 7,231,728 S720P probably damaging Het
Zeb2 T C 2: 44,996,409 N879D possibly damaging Het
Zfp266 T C 9: 20,505,127 T56A probably benign Het
Zxdc T A 6: 90,382,009 I541N probably damaging Het
Other mutations in Sri
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Sri APN 5 8063755 splice site probably null
IGL02442:Sri APN 5 8062411 missense probably damaging 1.00
IGL02661:Sri APN 5 8063252 splice site probably benign
IGL02675:Sri APN 5 8067534 missense probably damaging 1.00
R0847:Sri UTSW 5 8063755 splice site probably null
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0974:Sri UTSW 5 8059381 missense probably damaging 1.00
R1187:Sri UTSW 5 8059416 missense probably damaging 1.00
R2860:Sri UTSW 5 8067540 missense probably benign 0.26
R2861:Sri UTSW 5 8067540 missense probably benign 0.26
R3844:Sri UTSW 5 8064576 missense probably damaging 1.00
R4345:Sri UTSW 5 8059427 splice site probably null
R4575:Sri UTSW 5 8063693 missense probably damaging 1.00
R4704:Sri UTSW 5 8062430 splice site probably null
R5878:Sri UTSW 5 8059353 missense probably damaging 1.00
R6257:Sri UTSW 5 8059596 splice site probably null
R6944:Sri UTSW 5 8063365 missense probably benign 0.09
R7716:Sri UTSW 5 8056641 critical splice donor site probably null
R7929:Sri UTSW 5 8057652 intron probably benign
R7960:Sri UTSW 5 8064586 missense probably benign 0.04
R8316:Sri UTSW 5 8063317 missense probably damaging 0.96
X0061:Sri UTSW 5 8063368 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTGAAATGAGACAGTTCCATCC -3'
(R):5'- AGGTAGAAAAGTCACCCAGC -3'

Sequencing Primer
(F):5'- TCCATCCTTGATTATAATCCAGAGAG -3'
(R):5'- TCACCCAGCAAGAAAAGGTTAAAG -3'
Posted On2020-09-15