Incidental Mutation 'R7917:Zxdc'
ID 648138
Institutional Source Beutler Lab
Gene Symbol Zxdc
Ensembl Gene ENSMUSG00000034430
Gene Name ZXD family zinc finger C
Synonyms B930086F11Rik
MMRRC Submission 045965-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R7917 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 90346474-90380472 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90358991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 541 (I541N)
Ref Sequence ENSEMBL: ENSMUSP00000074619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045740] [ENSMUST00000075117] [ENSMUST00000113539]
AlphaFold Q8C8V1
Predicted Effect probably benign
Transcript: ENSMUST00000045740
SMART Domains Protein: ENSMUSP00000036329
Gene: ENSMUSG00000034430

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075117
AA Change: I541N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074619
Gene: ENSMUSG00000034430
AA Change: I541N

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113539
AA Change: I541N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109167
Gene: ENSMUSG00000034430
AA Change: I541N

DomainStartEndE-ValueType
low complexity region 44 95 N/A INTRINSIC
low complexity region 127 137 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
ZnF_C2H2 198 222 4.79e-3 SMART
ZnF_C2H2 231 255 4.3e-5 SMART
ZnF_C2H2 261 285 4.3e-5 SMART
ZnF_C2H2 291 313 1.69e-3 SMART
ZnF_C2H2 320 344 1.82e-3 SMART
ZnF_C2H2 351 375 1.26e-2 SMART
ZnF_C2H2 381 405 1.36e-2 SMART
ZnF_C2H2 411 435 5.21e-4 SMART
ZnF_C2H2 441 465 4.72e-2 SMART
ZnF_C2H2 474 499 3.07e-1 SMART
low complexity region 509 524 N/A INTRINSIC
low complexity region 657 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203493
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 109,958,933 (GRCm39) H730Q probably damaging Het
Adam20 A G 8: 41,249,408 (GRCm39) D506G probably damaging Het
Brinp1 A G 4: 68,823,190 (GRCm39) M1T probably null Het
Ccnc T A 4: 21,748,158 (GRCm39) N273K possibly damaging Het
Cfdp1 C A 8: 112,567,033 (GRCm39) V159L possibly damaging Het
Cyb5r1 T A 1: 134,334,638 (GRCm39) probably benign Het
Dsp C T 13: 38,351,615 (GRCm39) Q145* probably null Het
Exosc9 G A 3: 36,607,968 (GRCm39) V59I probably damaging Het
Fermt2 C G 14: 45,699,318 (GRCm39) R592T probably damaging Het
Fryl A G 5: 73,211,875 (GRCm39) S2381P probably damaging Het
Fscn2 G A 11: 120,258,082 (GRCm39) E335K possibly damaging Het
Hapln1 T C 13: 89,755,997 (GRCm39) I267T probably benign Het
Hdac9 T A 12: 34,483,209 (GRCm39) I93L probably benign Het
Igfn1 T C 1: 135,899,706 (GRCm39) D535G probably damaging Het
Ighv1-4 A T 12: 114,451,165 (GRCm39) F9I possibly damaging Het
Il3ra T A 14: 14,350,773 (GRCm38) H262Q possibly damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Mtg1 A T 7: 139,727,178 (GRCm39) D227V probably damaging Het
Nrcam T G 12: 44,620,546 (GRCm39) probably null Het
Or13g1 T C 7: 85,955,686 (GRCm39) T212A probably damaging Het
Or4f57 A C 2: 111,791,310 (GRCm39) V36G probably damaging Het
Or8b1 T A 9: 38,399,905 (GRCm39) Y193* probably null Het
Pcdha1 T A 18: 37,065,254 (GRCm39) D639E possibly damaging Het
Pcdhga8 T A 18: 37,860,669 (GRCm39) V575E possibly damaging Het
Pcif1 G T 2: 164,730,392 (GRCm39) R375L probably benign Het
Pcna A T 2: 132,094,929 (GRCm39) S10T probably benign Het
Pdzd8 A G 19: 59,333,518 (GRCm39) S168P probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Polq T A 16: 36,885,650 (GRCm39) D1842E probably benign Het
Rag2 A T 2: 101,460,040 (GRCm39) N117Y probably damaging Het
Scnn1g T C 7: 121,342,916 (GRCm39) Y290H probably damaging Het
Sri T C 5: 8,113,409 (GRCm39) probably null Het
Tek T C 4: 94,708,372 (GRCm39) V361A possibly damaging Het
Terf1 T A 1: 15,889,300 (GRCm39) L243Q probably damaging Het
Thrap3 G A 4: 126,069,213 (GRCm39) T646I probably damaging Het
Uba1y A G Y: 821,274 (GRCm39) I86V probably benign Het
Vmn2r29 A G 7: 7,234,727 (GRCm39) S720P probably damaging Het
Zeb2 T C 2: 44,886,421 (GRCm39) N879D possibly damaging Het
Zfp266 T C 9: 20,416,423 (GRCm39) T56A probably benign Het
Other mutations in Zxdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Zxdc APN 6 90,350,761 (GRCm39) missense probably damaging 1.00
IGL01943:Zxdc APN 6 90,349,520 (GRCm39) intron probably benign
IGL02406:Zxdc APN 6 90,375,818 (GRCm39) missense probably benign 0.00
IGL02596:Zxdc APN 6 90,350,691 (GRCm39) critical splice acceptor site probably null
IGL02623:Zxdc APN 6 90,359,352 (GRCm39) missense probably damaging 0.99
IGL02927:Zxdc APN 6 90,349,544 (GRCm39) missense probably damaging 1.00
IGL03230:Zxdc APN 6 90,350,785 (GRCm39) missense probably damaging 1.00
PIT4378001:Zxdc UTSW 6 90,350,698 (GRCm39) missense probably damaging 1.00
R0071:Zxdc UTSW 6 90,347,398 (GRCm39) missense probably damaging 1.00
R0194:Zxdc UTSW 6 90,349,519 (GRCm39) intron probably benign
R1065:Zxdc UTSW 6 90,355,885 (GRCm39) missense probably damaging 1.00
R1377:Zxdc UTSW 6 90,355,885 (GRCm39) missense probably damaging 1.00
R1405:Zxdc UTSW 6 90,361,225 (GRCm39) missense possibly damaging 0.50
R1405:Zxdc UTSW 6 90,361,225 (GRCm39) missense possibly damaging 0.50
R1692:Zxdc UTSW 6 90,355,933 (GRCm39) nonsense probably null
R2171:Zxdc UTSW 6 90,359,461 (GRCm39) missense possibly damaging 0.53
R3952:Zxdc UTSW 6 90,347,449 (GRCm39) splice site probably null
R4400:Zxdc UTSW 6 90,346,792 (GRCm39) missense probably damaging 1.00
R4660:Zxdc UTSW 6 90,355,820 (GRCm39) missense probably damaging 0.99
R4776:Zxdc UTSW 6 90,347,500 (GRCm39) missense probably damaging 1.00
R4781:Zxdc UTSW 6 90,349,535 (GRCm39) missense probably damaging 0.98
R4843:Zxdc UTSW 6 90,359,254 (GRCm39) missense probably damaging 1.00
R5028:Zxdc UTSW 6 90,359,320 (GRCm39) missense probably benign 0.44
R5260:Zxdc UTSW 6 90,359,075 (GRCm39) missense probably damaging 1.00
R5279:Zxdc UTSW 6 90,347,419 (GRCm39) missense possibly damaging 0.86
R5324:Zxdc UTSW 6 90,350,782 (GRCm39) missense probably damaging 1.00
R5363:Zxdc UTSW 6 90,359,128 (GRCm39) missense probably damaging 0.97
R5436:Zxdc UTSW 6 90,347,542 (GRCm39) missense probably damaging 0.99
R5872:Zxdc UTSW 6 90,347,281 (GRCm39) missense probably damaging 0.99
R5940:Zxdc UTSW 6 90,347,307 (GRCm39) missense probably damaging 1.00
R6762:Zxdc UTSW 6 90,359,165 (GRCm39) missense probably benign
R7175:Zxdc UTSW 6 90,346,645 (GRCm39) missense possibly damaging 0.85
R7197:Zxdc UTSW 6 90,355,819 (GRCm39) missense probably damaging 0.99
R7238:Zxdc UTSW 6 90,346,642 (GRCm39) missense unknown
R7247:Zxdc UTSW 6 90,361,155 (GRCm39) missense unknown
R7976:Zxdc UTSW 6 90,375,749 (GRCm39) missense probably benign 0.05
R8792:Zxdc UTSW 6 90,346,986 (GRCm39) missense probably benign 0.00
R8917:Zxdc UTSW 6 90,359,305 (GRCm39) missense probably benign 0.00
R9016:Zxdc UTSW 6 90,359,254 (GRCm39) missense probably damaging 1.00
R9076:Zxdc UTSW 6 90,349,821 (GRCm39) missense probably damaging 1.00
R9190:Zxdc UTSW 6 90,375,773 (GRCm39) missense probably damaging 0.96
R9216:Zxdc UTSW 6 90,359,189 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCTTAATCCGGCAACATAGTAACTG -3'
(R):5'- TCATCTGCACTGAAGCTGCC -3'

Sequencing Primer
(F):5'- ACAGATCTTGTACCTCAGCTGGAAG -3'
(R):5'- AGCTGCCTGGTTGGAGAAC -3'
Posted On 2020-09-15