Incidental Mutation 'R7917:Adam20'
ID 648144
Institutional Source Beutler Lab
Gene Symbol Adam20
Ensembl Gene ENSMUSG00000046282
Gene Name a disintegrin and metallopeptidase domain 20
Synonyms 4930529F22Rik
MMRRC Submission 045965-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7917 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 41246310-41250340 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41249408 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 506 (D506G)
Ref Sequence ENSEMBL: ENSMUSP00000057794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056331]
AlphaFold Q7M763
Predicted Effect probably damaging
Transcript: ENSMUST00000056331
AA Change: D506G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057794
Gene: ENSMUSG00000046282
AA Change: D506G

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 51 177 1.3e-19 PFAM
Pfam:Reprolysin_5 219 399 5.4e-16 PFAM
Pfam:Reprolysin_4 219 408 5.4e-11 PFAM
Pfam:Reprolysin 221 411 3.1e-45 PFAM
Pfam:Reprolysin_3 248 366 2.5e-13 PFAM
Pfam:Reprolysin_2 295 403 1e-14 PFAM
DISIN 429 504 4.29e-33 SMART
ACR 505 641 3.9e-74 SMART
transmembrane domain 703 722 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 109,958,933 (GRCm39) H730Q probably damaging Het
Brinp1 A G 4: 68,823,190 (GRCm39) M1T probably null Het
Ccnc T A 4: 21,748,158 (GRCm39) N273K possibly damaging Het
Cfdp1 C A 8: 112,567,033 (GRCm39) V159L possibly damaging Het
Cyb5r1 T A 1: 134,334,638 (GRCm39) probably benign Het
Dsp C T 13: 38,351,615 (GRCm39) Q145* probably null Het
Exosc9 G A 3: 36,607,968 (GRCm39) V59I probably damaging Het
Fermt2 C G 14: 45,699,318 (GRCm39) R592T probably damaging Het
Fryl A G 5: 73,211,875 (GRCm39) S2381P probably damaging Het
Fscn2 G A 11: 120,258,082 (GRCm39) E335K possibly damaging Het
Hapln1 T C 13: 89,755,997 (GRCm39) I267T probably benign Het
Hdac9 T A 12: 34,483,209 (GRCm39) I93L probably benign Het
Igfn1 T C 1: 135,899,706 (GRCm39) D535G probably damaging Het
Ighv1-4 A T 12: 114,451,165 (GRCm39) F9I possibly damaging Het
Il3ra T A 14: 14,350,773 (GRCm38) H262Q possibly damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Mtg1 A T 7: 139,727,178 (GRCm39) D227V probably damaging Het
Nrcam T G 12: 44,620,546 (GRCm39) probably null Het
Or13g1 T C 7: 85,955,686 (GRCm39) T212A probably damaging Het
Or4f57 A C 2: 111,791,310 (GRCm39) V36G probably damaging Het
Or8b1 T A 9: 38,399,905 (GRCm39) Y193* probably null Het
Pcdha1 T A 18: 37,065,254 (GRCm39) D639E possibly damaging Het
Pcdhga8 T A 18: 37,860,669 (GRCm39) V575E possibly damaging Het
Pcif1 G T 2: 164,730,392 (GRCm39) R375L probably benign Het
Pcna A T 2: 132,094,929 (GRCm39) S10T probably benign Het
Pdzd8 A G 19: 59,333,518 (GRCm39) S168P probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Polq T A 16: 36,885,650 (GRCm39) D1842E probably benign Het
Rag2 A T 2: 101,460,040 (GRCm39) N117Y probably damaging Het
Scnn1g T C 7: 121,342,916 (GRCm39) Y290H probably damaging Het
Sri T C 5: 8,113,409 (GRCm39) probably null Het
Tek T C 4: 94,708,372 (GRCm39) V361A possibly damaging Het
Terf1 T A 1: 15,889,300 (GRCm39) L243Q probably damaging Het
Thrap3 G A 4: 126,069,213 (GRCm39) T646I probably damaging Het
Uba1y A G Y: 821,274 (GRCm39) I86V probably benign Het
Vmn2r29 A G 7: 7,234,727 (GRCm39) S720P probably damaging Het
Zeb2 T C 2: 44,886,421 (GRCm39) N879D possibly damaging Het
Zfp266 T C 9: 20,416,423 (GRCm39) T56A probably benign Het
Zxdc T A 6: 90,358,991 (GRCm39) I541N probably damaging Het
Other mutations in Adam20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Adam20 APN 8 41,249,084 (GRCm39) missense probably benign 0.00
IGL01357:Adam20 APN 8 41,249,597 (GRCm39) missense probably benign 0.09
IGL01877:Adam20 APN 8 41,248,982 (GRCm39) missense probably benign 0.00
IGL02295:Adam20 APN 8 41,249,873 (GRCm39) missense probably damaging 1.00
IGL02683:Adam20 APN 8 41,248,621 (GRCm39) missense probably damaging 0.98
IGL03090:Adam20 APN 8 41,247,965 (GRCm39) missense probably benign 0.00
BB007:Adam20 UTSW 8 41,250,107 (GRCm39) missense probably benign 0.00
BB017:Adam20 UTSW 8 41,250,107 (GRCm39) missense probably benign 0.00
PIT4151001:Adam20 UTSW 8 41,248,081 (GRCm39) missense possibly damaging 0.58
PIT4696001:Adam20 UTSW 8 41,247,985 (GRCm39) missense probably benign 0.20
R0607:Adam20 UTSW 8 41,248,517 (GRCm39) missense probably benign 0.02
R0885:Adam20 UTSW 8 41,249,595 (GRCm39) missense probably benign 0.02
R1018:Adam20 UTSW 8 41,249,146 (GRCm39) nonsense probably null
R1147:Adam20 UTSW 8 41,248,655 (GRCm39) missense possibly damaging 0.82
R1147:Adam20 UTSW 8 41,248,655 (GRCm39) missense possibly damaging 0.82
R1421:Adam20 UTSW 8 41,249,784 (GRCm39) missense possibly damaging 0.48
R1739:Adam20 UTSW 8 41,249,595 (GRCm39) missense probably benign 0.02
R1778:Adam20 UTSW 8 41,249,698 (GRCm39) missense possibly damaging 0.92
R1844:Adam20 UTSW 8 41,249,080 (GRCm39) missense probably benign
R3814:Adam20 UTSW 8 41,248,712 (GRCm39) missense probably damaging 1.00
R3877:Adam20 UTSW 8 41,249,671 (GRCm39) missense possibly damaging 0.75
R4193:Adam20 UTSW 8 41,248,352 (GRCm39) missense probably damaging 0.99
R4357:Adam20 UTSW 8 41,248,084 (GRCm39) missense possibly damaging 0.61
R4846:Adam20 UTSW 8 41,248,048 (GRCm39) missense probably benign 0.10
R5452:Adam20 UTSW 8 41,248,801 (GRCm39) missense probably damaging 0.96
R6559:Adam20 UTSW 8 41,249,329 (GRCm39) missense probably benign 0.03
R6708:Adam20 UTSW 8 41,249,531 (GRCm39) missense probably damaging 1.00
R6730:Adam20 UTSW 8 41,249,696 (GRCm39) missense probably benign 0.23
R7194:Adam20 UTSW 8 41,249,449 (GRCm39) missense probably benign 0.45
R7323:Adam20 UTSW 8 41,248,421 (GRCm39) missense probably benign 0.45
R7930:Adam20 UTSW 8 41,250,107 (GRCm39) missense probably benign 0.00
R7954:Adam20 UTSW 8 41,249,581 (GRCm39) missense probably damaging 1.00
R7964:Adam20 UTSW 8 41,249,944 (GRCm39) missense probably damaging 0.97
R8006:Adam20 UTSW 8 41,248,944 (GRCm39) missense probably benign 0.02
R8125:Adam20 UTSW 8 41,247,973 (GRCm39) missense probably benign 0.01
R8134:Adam20 UTSW 8 41,249,101 (GRCm39) missense probably benign 0.02
R8435:Adam20 UTSW 8 41,248,072 (GRCm39) missense probably damaging 1.00
R8530:Adam20 UTSW 8 41,249,071 (GRCm39) missense probably damaging 1.00
R8695:Adam20 UTSW 8 41,248,865 (GRCm39) missense probably benign 0.13
R8757:Adam20 UTSW 8 41,248,943 (GRCm39) missense probably benign 0.00
R8871:Adam20 UTSW 8 41,248,601 (GRCm39) missense probably damaging 0.98
R8935:Adam20 UTSW 8 41,247,989 (GRCm39) missense probably benign 0.00
R9110:Adam20 UTSW 8 41,248,907 (GRCm39) missense probably benign 0.14
R9696:Adam20 UTSW 8 41,249,633 (GRCm39) missense probably damaging 0.99
R9703:Adam20 UTSW 8 41,248,971 (GRCm39) missense probably damaging 1.00
R9706:Adam20 UTSW 8 41,248,490 (GRCm39) missense probably benign 0.00
R9712:Adam20 UTSW 8 41,248,490 (GRCm39) missense probably benign 0.00
R9713:Adam20 UTSW 8 41,248,490 (GRCm39) missense probably benign 0.00
R9715:Adam20 UTSW 8 41,248,490 (GRCm39) missense probably benign 0.00
X0062:Adam20 UTSW 8 41,250,061 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTGTAACTCCAGGTGTGCC -3'
(R):5'- TCTCACATTGAACTCTGCCACAG -3'

Sequencing Primer
(F):5'- TAACTCCAGGTGTGCCCTTAATGATG -3'
(R):5'- AGGATGTCTGAGTCATGACATC -3'
Posted On 2020-09-15