Incidental Mutation 'R7917:Pdzd8'
ID648160
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7917 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59345086 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 168 (S168P)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099274]
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: S168P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: S168P

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 110,068,107 H730Q probably damaging Het
Adam20 A G 8: 40,796,371 D506G probably damaging Het
Brinp1 A G 4: 68,904,953 M1T probably null Het
Ccnc T A 4: 21,748,158 N273K possibly damaging Het
Cfdp1 C A 8: 111,840,401 V159L possibly damaging Het
Dsp C T 13: 38,167,639 Q145* probably null Het
Exosc9 G A 3: 36,553,819 V59I probably damaging Het
Fermt2 C G 14: 45,461,861 R592T probably damaging Het
Fryl A G 5: 73,054,532 S2381P probably damaging Het
Fscn2 G A 11: 120,367,256 E335K possibly damaging Het
Hapln1 T C 13: 89,607,878 I267T probably benign Het
Hdac9 T A 12: 34,433,210 I93L probably benign Het
Igfn1 T C 1: 135,971,968 D535G probably damaging Het
Ighv1-4 A T 12: 114,487,545 F9I possibly damaging Het
Il3ra T A 14: 14,350,773 H262Q possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mtg1 A T 7: 140,147,265 D227V probably damaging Het
Olfr1308 A C 2: 111,960,965 V36G probably damaging Het
Olfr309 T C 7: 86,306,478 T212A probably damaging Het
Olfr906 T A 9: 38,488,609 Y193* probably null Het
Pcdha1 T A 18: 36,932,201 D639E possibly damaging Het
Pcdhga8 T A 18: 37,727,616 V575E possibly damaging Het
Pcif1 G T 2: 164,888,472 R375L probably benign Het
Pcna A T 2: 132,253,009 S10T probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polq T A 16: 37,065,288 D1842E probably benign Het
Rag2 A T 2: 101,629,695 N117Y probably damaging Het
Scnn1g T C 7: 121,743,693 Y290H probably damaging Het
Sri T C 5: 8,063,409 probably null Het
Tek T C 4: 94,820,135 V361A possibly damaging Het
Terf1 T A 1: 15,819,076 L243Q probably damaging Het
Thrap3 G A 4: 126,175,420 T646I probably damaging Het
Uba1y A G Y: 821,274 I86V probably benign Het
Vmn2r29 A G 7: 7,231,728 S720P probably damaging Het
Zeb2 T C 2: 44,996,409 N879D possibly damaging Het
Zfp266 T C 9: 20,505,127 T56A probably benign Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Zxdc T A 6: 90,382,009 I541N probably damaging Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
Eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
keep UTSW 19 59301351 nonsense probably null
Stronghold UTSW 19 59345352 nonsense probably null
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
R7699:Pdzd8 UTSW 19 59344941 missense probably damaging 1.00
R7751:Pdzd8 UTSW 19 59344776 missense probably damaging 0.98
R7759:Pdzd8 UTSW 19 59299926 missense probably damaging 1.00
R7784:Pdzd8 UTSW 19 59327863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCAATCAGCGGGTCCTC -3'
(R):5'- GAGACCTGCTACTTCCTCAAC -3'

Sequencing Primer
(F):5'- CCAGTGGGTGAAGGGCAC -3'
(R):5'- ATCCTGTTCCTGTTCCGGGAG -3'
Posted On2020-09-15