Incidental Mutation 'R7918:Tbc1d8'
ID648162
Institutional Source Beutler Lab
Gene Symbol Tbc1d8
Ensembl Gene ENSMUSG00000003134
Gene NameTBC1 domain family, member 8
SynonymsGRAM domain, AD3, HBLP1, BUB2-like protein 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7918 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location39371492-39478755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 39402728 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 261 (F261C)
Ref Sequence ENSEMBL: ENSMUSP00000049967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054462] [ENSMUST00000192531] [ENSMUST00000193823]
Predicted Effect probably damaging
Transcript: ENSMUST00000054462
AA Change: F261C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049967
Gene: ENSMUSG00000003134
AA Change: F261C

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 3.6e-20 SMART
GRAM 285 353 2.77e-21 SMART
TBC 501 714 4.51e-54 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 991 N/A INTRINSIC
low complexity region 1030 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192531
SMART Domains Protein: ENSMUSP00000142143
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 80 98 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193823
AA Change: F261C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141750
Gene: ENSMUSG00000003134
AA Change: F261C

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 1.2e-22 SMART
GRAM 285 353 9.6e-24 SMART
TBC 501 714 2.2e-56 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330070K13Rik G A 5: 130,384,428 T30I unknown Het
Adam21 A G 12: 81,560,604 V128A possibly damaging Het
Adam26a T C 8: 43,569,529 Y308C probably damaging Het
Adam26b A G 8: 43,521,101 V288A probably benign Het
Ankrd29 A C 18: 12,295,922 L30R probably damaging Het
Bank1 A G 3: 136,093,362 I406T probably damaging Het
Cacna1g A G 11: 94,444,030 I817T probably benign Het
Catsperd T C 17: 56,631,564 F31L probably benign Het
Cep164 A G 9: 45,779,688 probably null Het
Clca4b T C 3: 144,913,272 Y702C probably damaging Het
Clstn1 A G 4: 149,644,051 I655V probably damaging Het
Dock1 A G 7: 135,145,418 E1486G probably damaging Het
Epha8 A G 4: 136,934,566 F573L probably benign Het
Exoc1 A G 5: 76,543,993 N323S probably benign Het
Exoc6b C T 6: 85,069,350 R19Q probably damaging Het
Gcsam T C 16: 45,620,139 *182R probably null Het
Ighv9-2 T C 12: 114,109,291 I21V probably benign Het
Ints2 G A 11: 86,222,217 T825M probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lad1 A G 1: 135,829,716 T398A probably benign Het
Lrfn2 T C 17: 49,071,184 V431A probably damaging Het
Mast2 T C 4: 116,435,535 I79M possibly damaging Het
Nup107 A G 10: 117,782,000 V171A probably benign Het
Olfr376 T C 11: 73,375,097 F119S probably damaging Het
Olfr888 T A 9: 38,108,807 Y35* probably null Het
Olfr970 C A 9: 39,820,110 T157K probably damaging Het
Pde4dip T A 3: 97,715,223 K1557* probably null Het
Plat C T 8: 22,773,639 P185S probably damaging Het
Plcg1 T G 2: 160,753,665 V511G probably damaging Het
Plxnb3 C T X: 73,767,645 A1258V probably benign Het
Rnf223 T C 4: 156,132,783 V205A probably benign Het
Slc13a1 G C 6: 24,118,066 T224R probably benign Het
Slc39a10 T A 1: 46,835,752 H130L possibly damaging Het
Sucnr1 T A 3: 60,086,369 I106N probably damaging Het
Syde2 T C 3: 146,002,415 probably null Het
Syne1 T C 10: 5,359,078 I644V possibly damaging Het
Tmem132e A G 11: 82,445,290 Y1066C probably damaging Het
Trip12 A C 1: 84,745,063 I1322S probably damaging Het
Tsnaxip1 A G 8: 105,844,535 I676V probably benign Het
Vmn1r231 A T 17: 20,889,974 Y226* probably null Het
Vmn2r63 G C 7: 42,903,531 A767G probably damaging Het
Wdr5b A G 16: 36,041,822 T104A probably damaging Het
Zbed5 T C 5: 129,901,663 V151A possibly damaging Het
Zc3h7b T C 15: 81,768,988 F31S probably damaging Het
Zfp874b A T 13: 67,474,160 C340S possibly damaging Het
Zmym4 T A 4: 126,911,004 probably null Het
Other mutations in Tbc1d8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tbc1d8 APN 1 39394129 missense probably damaging 0.96
IGL01501:Tbc1d8 APN 1 39389335 missense probably damaging 1.00
IGL01548:Tbc1d8 APN 1 39381304 missense probably damaging 0.96
IGL01884:Tbc1d8 APN 1 39376445 missense probably damaging 1.00
IGL01919:Tbc1d8 APN 1 39392253 missense probably damaging 1.00
IGL02123:Tbc1d8 APN 1 39376907 missense possibly damaging 0.54
IGL02123:Tbc1d8 APN 1 39380236 missense probably damaging 0.98
IGL02135:Tbc1d8 APN 1 39402810 missense probably damaging 1.00
IGL02317:Tbc1d8 APN 1 39376904 missense probably benign 0.00
IGL02325:Tbc1d8 APN 1 39394240 missense probably damaging 0.99
IGL02607:Tbc1d8 APN 1 39379511 missense probably benign 0.05
R0533:Tbc1d8 UTSW 1 39372774 missense possibly damaging 0.82
R0604:Tbc1d8 UTSW 1 39405326 missense probably damaging 1.00
R0612:Tbc1d8 UTSW 1 39372515 missense possibly damaging 0.92
R0639:Tbc1d8 UTSW 1 39391209 missense probably benign 0.00
R0976:Tbc1d8 UTSW 1 39406801 missense probably damaging 1.00
R1051:Tbc1d8 UTSW 1 39381453 nonsense probably null
R1605:Tbc1d8 UTSW 1 39391125 missense probably benign 0.38
R1622:Tbc1d8 UTSW 1 39380236 missense probably benign 0.00
R1710:Tbc1d8 UTSW 1 39406837 missense possibly damaging 0.89
R2419:Tbc1d8 UTSW 1 39376902 missense probably damaging 1.00
R2437:Tbc1d8 UTSW 1 39405287 splice site probably null
R2862:Tbc1d8 UTSW 1 39402696 nonsense probably null
R2870:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2870:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2873:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2874:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R3759:Tbc1d8 UTSW 1 39376465 missense probably damaging 1.00
R4127:Tbc1d8 UTSW 1 39372431 missense probably benign 0.05
R4154:Tbc1d8 UTSW 1 39386135 missense probably damaging 0.99
R4613:Tbc1d8 UTSW 1 39372708 missense probably damaging 0.98
R4737:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4738:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4739:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4740:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R5189:Tbc1d8 UTSW 1 39385132 missense probably benign 0.00
R5271:Tbc1d8 UTSW 1 39373767 missense probably damaging 0.97
R5308:Tbc1d8 UTSW 1 39389409 missense probably damaging 1.00
R5393:Tbc1d8 UTSW 1 39426088 missense probably damaging 0.99
R5529:Tbc1d8 UTSW 1 39372755 missense probably benign 0.42
R5897:Tbc1d8 UTSW 1 39392109 missense possibly damaging 0.95
R6160:Tbc1d8 UTSW 1 39372403 missense probably damaging 0.98
R6408:Tbc1d8 UTSW 1 39402899 missense probably damaging 0.99
R6409:Tbc1d8 UTSW 1 39372588 missense probably benign 0.00
R6554:Tbc1d8 UTSW 1 39406822 missense probably damaging 1.00
R6841:Tbc1d8 UTSW 1 39389374 missense possibly damaging 0.68
R7282:Tbc1d8 UTSW 1 39372533 missense probably benign 0.00
R7294:Tbc1d8 UTSW 1 39406762 missense probably damaging 1.00
R7384:Tbc1d8 UTSW 1 39394098 missense probably benign 0.00
R7718:Tbc1d8 UTSW 1 39376980 missense probably benign 0.00
R7881:Tbc1d8 UTSW 1 39386023 missense probably damaging 0.98
R7972:Tbc1d8 UTSW 1 39392169 missense probably damaging 1.00
R8269:Tbc1d8 UTSW 1 39426088 missense probably benign 0.00
R8352:Tbc1d8 UTSW 1 39405357 missense probably damaging 1.00
R8425:Tbc1d8 UTSW 1 39381409 missense probably damaging 1.00
R8452:Tbc1d8 UTSW 1 39405357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGTTTGAGTGGCACCAC -3'
(R):5'- AACTTGTGATCCCCTGGGTC -3'

Sequencing Primer
(F):5'- GGACAAGTCCTCTAGAGATCCTG -3'
(R):5'- GTGATCCCCTGGGTCGATATC -3'
Posted On2020-09-15