Incidental Mutation 'R7918:Kti12'
ID648172
Institutional Source Beutler Lab
Gene Symbol Kti12
Ensembl Gene ENSMUSG00000073775
Gene NameKTI12 homolog, chromatin associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7918 (G1)
Quality Score197.009
Status Not validated
Chromosome4
Chromosomal Location108847785-108849413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108848246 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 119 (E119A)
Ref Sequence ENSEMBL: ENSMUSP00000099799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296] [ENSMUST00000102738] [ENSMUST00000164855]
Predicted Effect probably benign
Transcript: ENSMUST00000030296
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102738
AA Change: E119A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099799
Gene: ENSMUSG00000073775
AA Change: E119A

DomainStartEndE-ValueType
Pfam:KTI12 1 347 3.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164855
SMART Domains Protein: ENSMUSP00000128780
Gene: ENSMUSG00000090551

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 47 64 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330070K13Rik G A 5: 130,384,428 T30I unknown Het
Adam21 A G 12: 81,560,604 V128A possibly damaging Het
Adam26a T C 8: 43,569,529 Y308C probably damaging Het
Adam26b A G 8: 43,521,101 V288A probably benign Het
Ankrd29 A C 18: 12,295,922 L30R probably damaging Het
Bank1 A G 3: 136,093,362 I406T probably damaging Het
Cacna1g A G 11: 94,444,030 I817T probably benign Het
Catsperd T C 17: 56,631,564 F31L probably benign Het
Cep164 A G 9: 45,779,688 probably null Het
Clca4b T C 3: 144,913,272 Y702C probably damaging Het
Clstn1 A G 4: 149,644,051 I655V probably damaging Het
Dock1 A G 7: 135,145,418 E1486G probably damaging Het
Epha8 A G 4: 136,934,566 F573L probably benign Het
Exoc1 A G 5: 76,543,993 N323S probably benign Het
Exoc6b C T 6: 85,069,350 R19Q probably damaging Het
Gcsam T C 16: 45,620,139 *182R probably null Het
Ighv9-2 T C 12: 114,109,291 I21V probably benign Het
Ints2 G A 11: 86,222,217 T825M probably damaging Het
Lad1 A G 1: 135,829,716 T398A probably benign Het
Lrfn2 T C 17: 49,071,184 V431A probably damaging Het
Mast2 T C 4: 116,435,535 I79M possibly damaging Het
Nup107 A G 10: 117,782,000 V171A probably benign Het
Olfr376 T C 11: 73,375,097 F119S probably damaging Het
Olfr888 T A 9: 38,108,807 Y35* probably null Het
Olfr970 C A 9: 39,820,110 T157K probably damaging Het
Pde4dip T A 3: 97,715,223 K1557* probably null Het
Plat C T 8: 22,773,639 P185S probably damaging Het
Plcg1 T G 2: 160,753,665 V511G probably damaging Het
Plxnb3 C T X: 73,767,645 A1258V probably benign Het
Rnf223 T C 4: 156,132,783 V205A probably benign Het
Slc13a1 G C 6: 24,118,066 T224R probably benign Het
Slc39a10 T A 1: 46,835,752 H130L possibly damaging Het
Sucnr1 T A 3: 60,086,369 I106N probably damaging Het
Syde2 T C 3: 146,002,415 probably null Het
Syne1 T C 10: 5,359,078 I644V possibly damaging Het
Tbc1d8 A C 1: 39,402,728 F261C probably damaging Het
Tmem132e A G 11: 82,445,290 Y1066C probably damaging Het
Trip12 A C 1: 84,745,063 I1322S probably damaging Het
Tsnaxip1 A G 8: 105,844,535 I676V probably benign Het
Vmn1r231 A T 17: 20,889,974 Y226* probably null Het
Vmn2r63 G C 7: 42,903,531 A767G probably damaging Het
Wdr5b A G 16: 36,041,822 T104A probably damaging Het
Zbed5 T C 5: 129,901,663 V151A possibly damaging Het
Zc3h7b T C 15: 81,768,988 F31S probably damaging Het
Zfp874b A T 13: 67,474,160 C340S possibly damaging Het
Zmym4 T A 4: 126,911,004 probably null Het
Other mutations in Kti12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02608:Kti12 APN 4 108848162 missense probably damaging 1.00
IGL02891:Kti12 APN 4 108848533 missense probably benign
IGL03142:Kti12 APN 4 108848165 missense probably damaging 1.00
BB002:Kti12 UTSW 4 108848246 missense probably benign
BB002:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB003:Kti12 UTSW 4 108848246 missense probably benign
BB003:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB004:Kti12 UTSW 4 108848246 missense probably benign
BB004:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB006:Kti12 UTSW 4 108848246 missense probably benign
BB006:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB012:Kti12 UTSW 4 108848246 missense probably benign
BB012:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB013:Kti12 UTSW 4 108848246 missense probably benign
BB013:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB014:Kti12 UTSW 4 108848246 missense probably benign
BB014:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB016:Kti12 UTSW 4 108848246 missense probably benign
BB016:Kti12 UTSW 4 108848247 missense probably benign 0.00
R0518:Kti12 UTSW 4 108848579 missense possibly damaging 0.95
R1681:Kti12 UTSW 4 108848858 missense probably damaging 1.00
R5510:Kti12 UTSW 4 108848624 missense probably damaging 1.00
R5522:Kti12 UTSW 4 108848423 missense possibly damaging 0.58
R6652:Kti12 UTSW 4 108848533 missense probably benign 0.00
R6774:Kti12 UTSW 4 108848455 missense probably benign 0.12
R7123:Kti12 UTSW 4 108848482 missense probably benign 0.00
R7856:Kti12 UTSW 4 108848246 missense probably benign
R7856:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7858:Kti12 UTSW 4 108848246 missense probably benign
R7858:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7859:Kti12 UTSW 4 108848246 missense probably benign
R7859:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7914:Kti12 UTSW 4 108848246 missense probably benign
R7914:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7915:Kti12 UTSW 4 108848246 missense probably benign
R7915:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7916:Kti12 UTSW 4 108848246 missense probably benign
R7916:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7917:Kti12 UTSW 4 108848246 missense probably benign
R7917:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7918:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7925:Kti12 UTSW 4 108848246 missense probably benign
R7925:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7926:Kti12 UTSW 4 108848246 missense probably benign
R7926:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7927:Kti12 UTSW 4 108848246 missense probably benign
R7927:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7929:Kti12 UTSW 4 108848246 missense probably benign
R7929:Kti12 UTSW 4 108848247 missense probably benign 0.00
R8099:Kti12 UTSW 4 108848374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTTGACGCCAAACATCCG -3'
(R):5'- GGATTTCCTCTGGATCCAGTTC -3'

Sequencing Primer
(F):5'- ATGGATGCCCCTGGAGATCATG -3'
(R):5'- GGATCCAGTTCCTTTGAGACAGC -3'
Posted On2020-09-15