Incidental Mutation 'R0023:Aknad1'
ID64818
Institutional Source Beutler Lab
Gene Symbol Aknad1
Ensembl Gene ENSMUSG00000049565
Gene NameAKNA domain containing 1
Synonyms4921525H12Rik
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0023 (G1)
Quality Score86
Status Validated
Chromosome3
Chromosomal Location108739658-108782309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108781185 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 610 (C610S)
Ref Sequence ENSEMBL: ENSMUSP00000121755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133931]
Predicted Effect probably benign
Transcript: ENSMUST00000133931
AA Change: C610S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121755
Gene: ENSMUSG00000049565
AA Change: C610S

DomainStartEndE-ValueType
Pfam:AKNA 322 415 2.5e-35 PFAM
low complexity region 557 572 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a domain found in an AT-hook-containing transcription factor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Aknad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Aknad1 APN 3 108775008 missense probably damaging 0.96
IGL01734:Aknad1 APN 3 108751901 missense probably benign 0.05
IGL01877:Aknad1 APN 3 108775090 missense probably damaging 0.99
IGL01964:Aknad1 APN 3 108778277 missense probably benign
IGL03091:Aknad1 APN 3 108751903 missense possibly damaging 0.76
IGL03172:Aknad1 APN 3 108781203 missense possibly damaging 0.53
R0023:Aknad1 UTSW 3 108781185 missense probably benign 0.00
R0238:Aknad1 UTSW 3 108781239 missense probably benign
R0238:Aknad1 UTSW 3 108781239 missense probably benign
R0294:Aknad1 UTSW 3 108775192 missense probably damaging 0.99
R0931:Aknad1 UTSW 3 108752023 missense probably damaging 1.00
R1147:Aknad1 UTSW 3 108752541 missense possibly damaging 0.89
R1147:Aknad1 UTSW 3 108752541 missense possibly damaging 0.89
R1179:Aknad1 UTSW 3 108752467 missense possibly damaging 0.78
R1579:Aknad1 UTSW 3 108752136 nonsense probably null
R1746:Aknad1 UTSW 3 108751783 missense possibly damaging 0.48
R2205:Aknad1 UTSW 3 108757293 missense probably damaging 1.00
R2316:Aknad1 UTSW 3 108781156 missense probably damaging 0.98
R2519:Aknad1 UTSW 3 108756468 missense probably damaging 0.97
R3087:Aknad1 UTSW 3 108756863 nonsense probably null
R4007:Aknad1 UTSW 3 108775282 missense probably benign 0.33
R4716:Aknad1 UTSW 3 108775101 critical splice donor site probably null
R4762:Aknad1 UTSW 3 108775231 missense possibly damaging 0.86
R4852:Aknad1 UTSW 3 108751740 missense probably damaging 0.99
R4910:Aknad1 UTSW 3 108781252 critical splice donor site probably null
R5191:Aknad1 UTSW 3 108751990 missense probably benign 0.04
R5191:Aknad1 UTSW 3 108752551 missense probably benign 0.11
R5918:Aknad1 UTSW 3 108752387 missense probably benign 0.00
R6246:Aknad1 UTSW 3 108751832 missense probably damaging 1.00
R6730:Aknad1 UTSW 3 108752339 missense possibly damaging 0.95
R7123:Aknad1 UTSW 3 108775244 nonsense probably null
R7641:Aknad1 UTSW 3 108771975 missense probably benign 0.41
R8181:Aknad1 UTSW 3 108752012 missense possibly damaging 0.91
R8377:Aknad1 UTSW 3 108781939 missense possibly damaging 0.53
R8430:Aknad1 UTSW 3 108751721 missense possibly damaging 0.95
X0023:Aknad1 UTSW 3 108752177 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACTCAAGCCAAGGCATTATCGCTG -3'
(R):5'- AGCCCATCCTATACTGACGGGAAAG -3'

Sequencing Primer
(F):5'- TTGTAAAAGGTAGGGTCCCTCAAC -3'
(R):5'- GCTAGCCATTCTGTGCTCAT -3'
Posted On2013-08-06