Incidental Mutation 'R7918:Slc13a1'
ID648182
Institutional Source Beutler Lab
Gene Symbol Slc13a1
Ensembl Gene ENSMUSG00000029700
Gene Namesolute carrier family 13 (sodium/sulfate symporters), member 1
SynonymsNaSi-1, Nas1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7918 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location24088283-24168092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 24118066 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 224 (T224R)
Ref Sequence ENSEMBL: ENSMUSP00000031713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031713]
Predicted Effect probably benign
Transcript: ENSMUST00000031713
AA Change: T224R

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031713
Gene: ENSMUSG00000029700
AA Change: T224R

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 5 578 9.6e-101 PFAM
Pfam:CitMHS 45 168 3.9e-14 PFAM
Pfam:CitMHS 226 521 3.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apical membrane Na(+)-sulfate cotransporter involved in sulfate homeostasis in the kidney. Defects in this gene lead to many pathophysiologic problems. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit hyposulfatemia, growth retardation, reduced female fertility, and spontaneous clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330070K13Rik G A 5: 130,384,428 T30I unknown Het
Adam21 A G 12: 81,560,604 V128A possibly damaging Het
Adam26a T C 8: 43,569,529 Y308C probably damaging Het
Adam26b A G 8: 43,521,101 V288A probably benign Het
Ankrd29 A C 18: 12,295,922 L30R probably damaging Het
Bank1 A G 3: 136,093,362 I406T probably damaging Het
Cacna1g A G 11: 94,444,030 I817T probably benign Het
Catsperd T C 17: 56,631,564 F31L probably benign Het
Cep164 A G 9: 45,779,688 probably null Het
Clca4b T C 3: 144,913,272 Y702C probably damaging Het
Clstn1 A G 4: 149,644,051 I655V probably damaging Het
Dock1 A G 7: 135,145,418 E1486G probably damaging Het
Epha8 A G 4: 136,934,566 F573L probably benign Het
Exoc1 A G 5: 76,543,993 N323S probably benign Het
Exoc6b C T 6: 85,069,350 R19Q probably damaging Het
Gcsam T C 16: 45,620,139 *182R probably null Het
Ighv9-2 T C 12: 114,109,291 I21V probably benign Het
Ints2 G A 11: 86,222,217 T825M probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lad1 A G 1: 135,829,716 T398A probably benign Het
Lrfn2 T C 17: 49,071,184 V431A probably damaging Het
Mast2 T C 4: 116,435,535 I79M possibly damaging Het
Nup107 A G 10: 117,782,000 V171A probably benign Het
Olfr376 T C 11: 73,375,097 F119S probably damaging Het
Olfr888 T A 9: 38,108,807 Y35* probably null Het
Olfr970 C A 9: 39,820,110 T157K probably damaging Het
Pde4dip T A 3: 97,715,223 K1557* probably null Het
Plat C T 8: 22,773,639 P185S probably damaging Het
Plcg1 T G 2: 160,753,665 V511G probably damaging Het
Plxnb3 C T X: 73,767,645 A1258V probably benign Het
Rnf223 T C 4: 156,132,783 V205A probably benign Het
Slc39a10 T A 1: 46,835,752 H130L possibly damaging Het
Sucnr1 T A 3: 60,086,369 I106N probably damaging Het
Syde2 T C 3: 146,002,415 probably null Het
Syne1 T C 10: 5,359,078 I644V possibly damaging Het
Tbc1d8 A C 1: 39,402,728 F261C probably damaging Het
Tmem132e A G 11: 82,445,290 Y1066C probably damaging Het
Trip12 A C 1: 84,745,063 I1322S probably damaging Het
Tsnaxip1 A G 8: 105,844,535 I676V probably benign Het
Vmn1r231 A T 17: 20,889,974 Y226* probably null Het
Vmn2r63 G C 7: 42,903,531 A767G probably damaging Het
Wdr5b A G 16: 36,041,822 T104A probably damaging Het
Zbed5 T C 5: 129,901,663 V151A possibly damaging Het
Zc3h7b T C 15: 81,768,988 F31S probably damaging Het
Zfp874b A T 13: 67,474,160 C340S possibly damaging Het
Zmym4 T A 4: 126,911,004 probably null Het
Other mutations in Slc13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc13a1 APN 6 24118017 missense possibly damaging 0.55
IGL01096:Slc13a1 APN 6 24104077 missense probably damaging 0.97
IGL01788:Slc13a1 APN 6 24134372 missense probably damaging 0.96
IGL02028:Slc13a1 APN 6 24118031 missense probably benign 0.00
IGL02238:Slc13a1 APN 6 24103483 missense probably benign 0.00
IGL02525:Slc13a1 APN 6 24137136 missense probably damaging 1.00
IGL02741:Slc13a1 APN 6 24150708 critical splice donor site probably null
IGL02894:Slc13a1 APN 6 24137042 splice site probably benign
IGL03086:Slc13a1 APN 6 24118003 missense probably damaging 1.00
munchkin UTSW 6 24090796 nonsense probably null
R0294:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R0419:Slc13a1 UTSW 6 24100293 missense probably damaging 0.99
R1249:Slc13a1 UTSW 6 24133650 missense probably benign 0.01
R1401:Slc13a1 UTSW 6 24118083 splice site probably null
R1868:Slc13a1 UTSW 6 24118000 missense probably damaging 1.00
R2191:Slc13a1 UTSW 6 24134397 missense possibly damaging 0.71
R2940:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R3740:Slc13a1 UTSW 6 24134477 missense probably damaging 1.00
R4326:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4327:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4389:Slc13a1 UTSW 6 24092398 splice site probably null
R4520:Slc13a1 UTSW 6 24134513 missense probably benign 0.18
R4771:Slc13a1 UTSW 6 24100340 nonsense probably null
R4883:Slc13a1 UTSW 6 24134357 missense probably benign 0.01
R5133:Slc13a1 UTSW 6 24103429 missense possibly damaging 0.95
R5213:Slc13a1 UTSW 6 24108159 missense probably damaging 1.00
R5310:Slc13a1 UTSW 6 24134374 missense probably benign 0.02
R5504:Slc13a1 UTSW 6 24150744 missense possibly damaging 0.83
R5971:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
R6214:Slc13a1 UTSW 6 24090796 nonsense probably null
R6215:Slc13a1 UTSW 6 24090796 nonsense probably null
R6526:Slc13a1 UTSW 6 24097612 missense probably damaging 0.97
R6562:Slc13a1 UTSW 6 24150793 missense probably benign 0.35
R6573:Slc13a1 UTSW 6 24137095 missense probably damaging 1.00
R6902:Slc13a1 UTSW 6 24097666 missense possibly damaging 0.65
R7184:Slc13a1 UTSW 6 24092312 missense probably damaging 0.99
R7536:Slc13a1 UTSW 6 24100331 missense probably damaging 1.00
U15987:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
Z1177:Slc13a1 UTSW 6 24133695 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCTCGTCTAGGGTTTGCTG -3'
(R):5'- AGCACATTGTCACCTTTGTTG -3'

Sequencing Primer
(F):5'- GTCCACTTGTTGAATCATCAATCTG -3'
(R):5'- GTTTGACCACAAACTGTTCTC -3'
Posted On2020-09-15