Incidental Mutation 'R0023:Efcab7'
ID64821
Institutional Source Beutler Lab
Gene Symbol Efcab7
Ensembl Gene ENSMUSG00000073791
Gene NameEF-hand calcium binding domain 7
Synonyms
MMRRC Submission 038318-MU
Accession Numbers

Genbank: NM_145549; MGI: 2385199

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0023 (G1)
Quality Score106
Status Validated
Chromosome4
Chromosomal Location99829198-99912788 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 99901637 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097959]
Predicted Effect probably benign
Transcript: ENSMUST00000097959
SMART Domains Protein: ENSMUSP00000095572
Gene: ENSMUSG00000073791

DomainStartEndE-ValueType
low complexity region 85 99 N/A INTRINSIC
SCOP:d2pvba_ 339 408 2e-4 SMART
Blast:EFh 348 376 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123830
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Efcab7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Efcab7 APN 4 99831463 missense probably benign 0.12
3-1:Efcab7 UTSW 4 99901769 missense possibly damaging 0.83
R0085:Efcab7 UTSW 4 99904680 unclassified probably benign
R0122:Efcab7 UTSW 4 99892363 splice site probably benign
R0326:Efcab7 UTSW 4 99831394 missense possibly damaging 0.86
R0382:Efcab7 UTSW 4 99901769 missense possibly damaging 0.83
R0410:Efcab7 UTSW 4 99878285 critical splice donor site probably null
R0413:Efcab7 UTSW 4 99909746 missense probably damaging 1.00
R0611:Efcab7 UTSW 4 99901689 missense probably damaging 1.00
R0689:Efcab7 UTSW 4 99904784 missense probably damaging 1.00
R1114:Efcab7 UTSW 4 99878250 nonsense probably null
R1459:Efcab7 UTSW 4 99912547 missense probably null 1.00
R1722:Efcab7 UTSW 4 99900618 missense probably benign 0.36
R1932:Efcab7 UTSW 4 99911018 missense probably damaging 1.00
R1954:Efcab7 UTSW 4 99900690 missense probably damaging 1.00
R2305:Efcab7 UTSW 4 99831481 missense possibly damaging 0.95
R2358:Efcab7 UTSW 4 99831586 unclassified probably benign
R2845:Efcab7 UTSW 4 99909638 missense probably damaging 0.99
R3915:Efcab7 UTSW 4 99878173 missense probably damaging 0.98
R4469:Efcab7 UTSW 4 99909704 missense possibly damaging 0.73
R4686:Efcab7 UTSW 4 99878116 missense probably benign 0.29
R4737:Efcab7 UTSW 4 99831568 nonsense probably null
R4970:Efcab7 UTSW 4 99831543 missense probably damaging 1.00
R5120:Efcab7 UTSW 4 99897491 missense probably damaging 1.00
R5264:Efcab7 UTSW 4 99878170 missense probably benign 0.27
R5366:Efcab7 UTSW 4 99904734 missense possibly damaging 0.95
R5901:Efcab7 UTSW 4 99909744 missense probably damaging 0.99
R6255:Efcab7 UTSW 4 99829390 unclassified probably benign
R6438:Efcab7 UTSW 4 99909772 missense probably benign 0.39
R6451:Efcab7 UTSW 4 99831501 nonsense probably null
R6717:Efcab7 UTSW 4 99904734 missense possibly damaging 0.95
R6766:Efcab7 UTSW 4 99877959 frame shift probably null
R6855:Efcab7 UTSW 4 99900580 nonsense probably null
R6865:Efcab7 UTSW 4 99912596 missense probably damaging 1.00
R7868:Efcab7 UTSW 4 99888957 missense probably benign 0.01
R7893:Efcab7 UTSW 4 99888861 missense probably damaging 1.00
R8069:Efcab7 UTSW 4 99829378 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAAGGCTCTACCGCTGAGCTATAC -3'
(R):5'- GAGAATGAGGGATGCCACACTCAC -3'

Sequencing Primer
(F):5'- ggttcaagtcttagcacacac -3'
(R):5'- GGATGCCACACTCACCTCTG -3'
Posted On2013-08-06