Incidental Mutation 'R7919:Gatb'
ID648221
Institutional Source Beutler Lab
Gene Symbol Gatb
Ensembl Gene ENSMUSG00000028085
Gene Nameglutamyl-tRNA(Gln) amidotransferase, subunit B
SynonymsPet112, Pet112l, 9430026F02Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R7919 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location85574119-85655622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85604521 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 194 (S194R)
Ref Sequence ENSEMBL: ENSMUSP00000119949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107672] [ENSMUST00000107674] [ENSMUST00000127348] [ENSMUST00000154148]
Predicted Effect probably damaging
Transcript: ENSMUST00000107672
AA Change: S194R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103299
Gene: ENSMUSG00000028085
AA Change: S194R

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-103 PFAM
Pfam:GatB_Yqey 406 472 6.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107674
AA Change: S194R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103301
Gene: ENSMUSG00000028085
AA Change: S194R

DomainStartEndE-ValueType
Pfam:GatB_N 64 354 6.7e-105 PFAM
GatB_Yqey 406 518 2.09e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127348
AA Change: S194R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119949
Gene: ENSMUSG00000028085
AA Change: S194R

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-101 PFAM
GatB_Yqey 406 555 4.13e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T G 3: 138,179,550 K95T probably damaging Het
9430097D07Rik T C 2: 32,574,449 T113A unknown Het
Abcc2 T C 19: 43,816,809 Y701H probably damaging Het
Adcy2 T A 13: 68,887,972 H190L probably benign Het
Arhgef15 T C 11: 68,947,605 T623A probably benign Het
Armc3 A G 2: 19,286,095 T462A probably benign Het
Calhm2 C T 19: 47,133,008 V241M possibly damaging Het
Cdc25c T C 18: 34,735,376 I314V probably damaging Het
Cntrl G A 2: 35,127,401 D407N probably benign Het
Dnah5 A G 15: 28,350,596 E2588G probably damaging Het
Dnm1 T A 2: 32,339,978 N178Y probably damaging Het
Eaf2 T A 16: 36,810,552 E86D probably damaging Het
Elf1 C A 14: 79,560,899 D75E probably benign Het
Fem1c T C 18: 46,524,303 T115A probably damaging Het
Garnl3 A G 2: 33,046,599 V186A probably benign Het
Gm10775 T A 13: 65,260,099 N71K unknown Het
Gm19965 T A 1: 116,822,120 C510* probably null Het
Hydin A G 8: 110,267,339 T2A unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Jag1 G A 2: 137,088,446 T726M probably damaging Het
Kank1 A G 19: 25,431,075 D1306G probably damaging Het
Krt26 T A 11: 99,333,594 E366V probably damaging Het
Ksr2 A G 5: 117,761,353 E872G possibly damaging Het
Med6 G A 12: 81,573,847 R242* probably null Het
Meis2 A G 2: 115,867,307 V370A probably benign Het
Mta2 C T 19: 8,949,134 R480* probably null Het
Mup3 A T 4: 62,084,592 N177K probably damaging Het
Myo15 T A 11: 60,526,530 V3435E probably damaging Het
Ncapg A G 5: 45,696,048 T880A probably benign Het
Obox1 A T 7: 15,556,331 K200* probably null Het
Olfr1045 A T 2: 86,198,265 C162* probably null Het
Ovgp1 T A 3: 105,981,285 V319D probably damaging Het
Plxdc2 A T 2: 16,548,225 I145F probably damaging Het
Prr30 T C 14: 101,199,111 N5S possibly damaging Het
Ptcd3 T C 6: 71,903,454 Y95C probably damaging Het
Rsl1d1 A G 16: 11,202,433 S44P probably benign Het
Sh3gl2 A G 4: 85,355,358 E49G probably benign Het
Shroom1 A G 11: 53,463,393 T47A probably benign Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Stx1b A G 7: 127,807,335 S281P probably benign Het
Tg A T 15: 66,684,074 I872F possibly damaging Het
Ubqln3 C T 7: 104,141,192 A564T probably benign Het
Vsnl1 T C 12: 11,332,086 E98G possibly damaging Het
Vwf T C 6: 125,647,859 L1857P Het
Wars C T 12: 108,881,104 E125K probably benign Het
Wnt16 G A 6: 22,291,050 S159N probably benign Het
Zcchc14 A G 8: 121,604,173 F817S probably damaging Het
Zufsp A G 10: 33,949,112 S125P possibly damaging Het
Other mutations in Gatb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gatb APN 3 85601920 missense possibly damaging 0.95
IGL00963:Gatb APN 3 85618948 missense probably benign 0.00
IGL01363:Gatb APN 3 85652345 missense probably damaging 1.00
IGL01650:Gatb APN 3 85613484 missense possibly damaging 0.68
IGL01973:Gatb APN 3 85611424 missense probably damaging 1.00
IGL02195:Gatb APN 3 85604448 missense probably benign 0.00
IGL02670:Gatb APN 3 85613551 splice site probably null
IGL02992:Gatb APN 3 85618916 missense probably damaging 1.00
IGL03025:Gatb APN 3 85575874 missense probably damaging 0.99
IGL03035:Gatb APN 3 85601947 missense probably damaging 1.00
IGL03090:Gatb APN 3 85619023 intron probably benign
R1313:Gatb UTSW 3 85653826 missense probably benign 0.01
R1851:Gatb UTSW 3 85618877 missense probably damaging 0.99
R1852:Gatb UTSW 3 85618877 missense probably damaging 0.99
R2134:Gatb UTSW 3 85611370 missense probably damaging 1.00
R2209:Gatb UTSW 3 85653805 missense probably benign 0.03
R5189:Gatb UTSW 3 85636931 missense probably benign 0.00
R5218:Gatb UTSW 3 85604444 missense probably benign
R5857:Gatb UTSW 3 85575932 missense probably damaging 1.00
R5871:Gatb UTSW 3 85653776 nonsense probably null
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6430:Gatb UTSW 3 85637038 missense probably benign 0.01
R6661:Gatb UTSW 3 85652419 splice site probably null
R7184:Gatb UTSW 3 85636951 nonsense probably null
R7210:Gatb UTSW 3 85574220 missense probably benign
R7501:Gatb UTSW 3 85636990 missense probably damaging 0.99
R8335:Gatb UTSW 3 85574321 critical splice donor site probably null
R8536:Gatb UTSW 3 85604561 missense probably damaging 0.99
X0013:Gatb UTSW 3 85601861 missense probably damaging 1.00
Z1177:Gatb UTSW 3 85636973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCAGCTTTCAGTTCTGG -3'
(R):5'- TGGGCTTGACAGACTCATCAG -3'

Sequencing Primer
(F):5'- CTGGTCTAGCAACTAAATCCGTG -3'
(R):5'- TGCTTAAGGACATCCAGCTG -3'
Posted On2020-09-15