Incidental Mutation 'R7920:Inpp4a'
ID 648260
Institutional Source Beutler Lab
Gene Symbol Inpp4a
Ensembl Gene ENSMUSG00000026113
Gene Name inositol polyphosphate-4-phosphatase, type I
Synonyms 107kDa
MMRRC Submission 045967-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.209) question?
Stock # R7920 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 37338946-37449817 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37406886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 210 (S210T)
Ref Sequence ENSEMBL: ENSMUSP00000121107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027287] [ENSMUST00000058307] [ENSMUST00000114933] [ENSMUST00000132401] [ENSMUST00000132615] [ENSMUST00000136846] [ENSMUST00000137266] [ENSMUST00000140264] [ENSMUST00000168546] [ENSMUST00000193774]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027287
AA Change: S210T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027287
Gene: ENSMUSG00000026113
AA Change: S210T

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058307
SMART Domains Protein: ENSMUSP00000057233
Gene: ENSMUSG00000026113

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114933
SMART Domains Protein: ENSMUSP00000110583
Gene: ENSMUSG00000026113

DomainStartEndE-ValueType
low complexity region 300 325 N/A INTRINSIC
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132401
AA Change: S210T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123071
Gene: ENSMUSG00000026113
AA Change: S210T

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 602 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132615
AA Change: S210T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000115249
Gene: ENSMUSG00000026113
AA Change: S210T

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136846
AA Change: S210T

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121518
Gene: ENSMUSG00000026113
AA Change: S210T

DomainStartEndE-ValueType
Blast:C2 49 142 9e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 559 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137266
AA Change: S210T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121803
Gene: ENSMUSG00000026113
AA Change: S210T

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140264
AA Change: S210T

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121107
Gene: ENSMUSG00000026113
AA Change: S210T

DomainStartEndE-ValueType
Blast:C2 49 142 7e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 564 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168546
SMART Domains Protein: ENSMUSP00000130443
Gene: ENSMUSG00000026113

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193774
SMART Domains Protein: ENSMUSP00000142118
Gene: ENSMUSG00000026113

DomainStartEndE-ValueType
Blast:C2 45 87 7e-13 BLAST
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Mg++ independent enzyme that hydrolyzes the 4-position phosphate from the inositol ring of phosphatidylinositol 3,4-bisphosphate, inositol 1,3,4-trisphosphate, and inositol 3,4-bisphosphate. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit small size, ataxia, loss of cerebellar and hippocampal CA1 neurons, and death by 24 days of age from seizures and/or malnutrition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,818,130 (GRCm39) S9P probably damaging Het
AI661453 A T 17: 47,779,331 (GRCm39) Q1019L unknown Het
Aldh1a1 T A 19: 20,595,301 (GRCm39) W77R probably damaging Het
Cc2d2a T C 5: 43,896,651 (GRCm39) I1516T probably benign Het
Ccdc149 T A 5: 52,562,436 (GRCm39) I197F probably damaging Het
Cfap119 A G 7: 127,187,125 (GRCm39) M46T probably benign Het
Cfb A G 17: 35,079,867 (GRCm39) V176A probably benign Het
Chordc1 A G 9: 18,213,397 (GRCm39) K83E probably benign Het
Cic G A 7: 24,971,384 (GRCm39) V372M probably benign Het
Coq2 T A 5: 100,811,741 (GRCm39) probably benign Het
Cradd A G 10: 95,158,573 (GRCm39) L58P probably damaging Het
Crim1 A T 17: 78,610,493 (GRCm39) D316V probably damaging Het
Cyb5rl C A 4: 106,928,205 (GRCm39) L114I possibly damaging Het
Cyp2c69 T G 19: 39,866,247 (GRCm39) probably null Het
Ddhd1 A G 14: 45,894,927 (GRCm39) F181S probably damaging Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dmrt1 T C 19: 25,483,383 (GRCm39) S56P possibly damaging Het
Dnah12 A G 14: 26,578,499 (GRCm39) E3086G possibly damaging Het
Dnah5 A T 15: 28,453,368 (GRCm39) M4380L probably benign Het
Dph7 A T 2: 24,861,624 (GRCm39) M346L probably benign Het
Eef1ece2 A G 16: 20,456,442 (GRCm39) E428G possibly damaging Het
Egf C T 3: 129,529,489 (GRCm39) R307H probably benign Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Fcna T C 2: 25,516,298 (GRCm39) K112E probably benign Het
Fkbp5 A T 17: 28,648,213 (GRCm39) N125K possibly damaging Het
Foxo3 C T 10: 42,073,765 (GRCm39) V251I possibly damaging Het
Fryl T A 5: 73,259,150 (GRCm39) probably null Het
Fsip2 A G 2: 82,781,365 (GRCm39) E253G possibly damaging Het
Gprc6a T A 10: 51,491,026 (GRCm39) T908S probably benign Het
Grin2c A T 11: 115,144,970 (GRCm39) F560L probably benign Het
Hao1 T A 2: 134,390,172 (GRCm39) N56Y probably damaging Het
Haus3 T C 5: 34,325,046 (GRCm39) I204M probably benign Het
Htr3b C A 9: 48,848,456 (GRCm39) C263F probably damaging Het
Ica1 A T 6: 8,742,274 (GRCm39) C120S probably benign Het
Inpp5d T G 1: 87,633,671 (GRCm39) I699S probably damaging Het
Kcng1 A G 2: 168,104,904 (GRCm39) V314A probably benign Het
Lcn11 G A 2: 25,669,343 (GRCm39) V167M possibly damaging Het
Lingo3 C A 10: 80,670,382 (GRCm39) R516L probably benign Het
Lrmda T C 14: 22,646,546 (GRCm39) V151A probably damaging Het
Ly6g5b A C 17: 35,333,578 (GRCm39) I133R probably damaging Het
Mcidas G A 13: 113,135,521 (GRCm39) G315S probably damaging Het
Miip C T 4: 147,947,375 (GRCm39) G236S probably benign Het
Mroh7 T C 4: 106,564,773 (GRCm39) T562A probably benign Het
Nlrc4 A G 17: 74,734,114 (GRCm39) M933T probably benign Het
Or13a25 A T 7: 140,247,814 (GRCm39) S198C possibly damaging Het
Pkhd1 A T 1: 20,345,759 (GRCm39) D2756E probably damaging Het
Plekhm2 T C 4: 141,359,432 (GRCm39) D445G probably damaging Het
Ppp1r12c C T 7: 4,486,354 (GRCm39) G605D probably benign Het
Pygb T A 2: 150,628,922 (GRCm39) N45K possibly damaging Het
Scn4b A G 9: 45,058,069 (GRCm39) T54A probably damaging Het
Scrt1 T A 15: 76,403,417 (GRCm39) H191L unknown Het
Sdc3 A G 4: 130,546,507 (GRCm39) M289V probably benign Het
Shb C T 4: 45,489,054 (GRCm39) probably null Het
Slc1a5 A G 7: 16,527,795 (GRCm39) T364A probably damaging Het
Slc25a27 A G 17: 43,960,564 (GRCm39) V218A probably benign Het
Slc39a4 C T 15: 76,498,285 (GRCm39) G384D probably damaging Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Styxl2 T A 1: 165,927,465 (GRCm39) N716Y possibly damaging Het
Tmem67 A T 4: 12,089,284 (GRCm39) probably null Het
Tonsl C T 15: 76,518,787 (GRCm39) R544H probably damaging Het
Trex1 A G 9: 108,887,157 (GRCm39) V278A unknown Het
Ttn A T 2: 76,625,501 (GRCm39) D15107E probably damaging Het
Tubgcp5 A G 7: 55,466,310 (GRCm39) T621A probably benign Het
Zfhx4 T C 3: 5,465,515 (GRCm39) V1916A possibly damaging Het
Zfp260 A T 7: 29,805,017 (GRCm39) K306* probably null Het
Zkscan7 A T 9: 122,724,974 (GRCm39) T648S probably benign Het
Zscan4c T A 7: 10,743,699 (GRCm39) F433I possibly damaging Het
Other mutations in Inpp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Inpp4a APN 1 37,427,986 (GRCm39) missense probably damaging 1.00
IGL01821:Inpp4a APN 1 37,416,798 (GRCm39) missense probably damaging 1.00
IGL02015:Inpp4a APN 1 37,428,793 (GRCm39) missense probably damaging 1.00
IGL02036:Inpp4a APN 1 37,416,650 (GRCm39) intron probably benign
IGL02040:Inpp4a APN 1 37,435,166 (GRCm39) missense probably damaging 0.99
IGL02082:Inpp4a APN 1 37,405,708 (GRCm39) intron probably benign
IGL02318:Inpp4a APN 1 37,407,384 (GRCm39) missense probably damaging 1.00
IGL02555:Inpp4a APN 1 37,419,049 (GRCm39) missense possibly damaging 0.70
IGL02622:Inpp4a APN 1 37,418,115 (GRCm39) missense probably benign 0.26
stultified UTSW 1 37,426,911 (GRCm39) missense probably damaging 0.99
R0265:Inpp4a UTSW 1 37,418,067 (GRCm39) missense probably damaging 1.00
R0388:Inpp4a UTSW 1 37,435,241 (GRCm39) missense probably damaging 0.96
R0543:Inpp4a UTSW 1 37,408,573 (GRCm39) intron probably benign
R1269:Inpp4a UTSW 1 37,428,823 (GRCm39) missense probably benign 0.01
R1719:Inpp4a UTSW 1 37,437,880 (GRCm39) missense probably damaging 1.00
R1799:Inpp4a UTSW 1 37,432,059 (GRCm39) missense possibly damaging 0.56
R2127:Inpp4a UTSW 1 37,406,000 (GRCm39) missense probably benign 0.08
R2143:Inpp4a UTSW 1 37,426,827 (GRCm39) missense probably damaging 1.00
R2174:Inpp4a UTSW 1 37,435,211 (GRCm39) missense probably damaging 1.00
R2258:Inpp4a UTSW 1 37,416,777 (GRCm39) missense probably damaging 1.00
R2327:Inpp4a UTSW 1 37,405,247 (GRCm39) missense probably damaging 0.96
R2437:Inpp4a UTSW 1 37,432,037 (GRCm39) missense probably damaging 1.00
R2897:Inpp4a UTSW 1 37,405,675 (GRCm39) missense probably benign 0.07
R2898:Inpp4a UTSW 1 37,405,675 (GRCm39) missense probably benign 0.07
R4830:Inpp4a UTSW 1 37,410,861 (GRCm39) missense probably damaging 1.00
R4934:Inpp4a UTSW 1 37,426,922 (GRCm39) missense possibly damaging 0.74
R5141:Inpp4a UTSW 1 37,419,168 (GRCm39) missense probably benign 0.17
R5152:Inpp4a UTSW 1 37,397,616 (GRCm39) missense possibly damaging 0.88
R5627:Inpp4a UTSW 1 37,406,854 (GRCm39) missense probably damaging 0.96
R5789:Inpp4a UTSW 1 37,411,410 (GRCm39) missense possibly damaging 0.75
R6004:Inpp4a UTSW 1 37,411,451 (GRCm39) missense probably damaging 0.99
R6107:Inpp4a UTSW 1 37,416,829 (GRCm39) missense probably damaging 0.98
R6180:Inpp4a UTSW 1 37,419,183 (GRCm39) missense probably benign
R6434:Inpp4a UTSW 1 37,437,919 (GRCm39) missense probably damaging 1.00
R6571:Inpp4a UTSW 1 37,426,839 (GRCm39) missense probably damaging 1.00
R6766:Inpp4a UTSW 1 37,411,422 (GRCm39) missense probably damaging 1.00
R6992:Inpp4a UTSW 1 37,428,772 (GRCm39) missense probably damaging 0.98
R7025:Inpp4a UTSW 1 37,408,504 (GRCm39) missense probably benign 0.00
R7126:Inpp4a UTSW 1 37,413,353 (GRCm39) missense probably benign 0.00
R7473:Inpp4a UTSW 1 37,408,534 (GRCm39) missense probably benign 0.37
R7509:Inpp4a UTSW 1 37,426,911 (GRCm39) missense probably damaging 0.99
R7654:Inpp4a UTSW 1 37,413,179 (GRCm39) splice site probably null
R8273:Inpp4a UTSW 1 37,407,520 (GRCm39) intron probably benign
R8739:Inpp4a UTSW 1 37,422,207 (GRCm39) intron probably benign
R9158:Inpp4a UTSW 1 37,442,552 (GRCm39) missense possibly damaging 0.76
R9281:Inpp4a UTSW 1 37,410,850 (GRCm39) missense probably damaging 1.00
R9678:Inpp4a UTSW 1 37,405,952 (GRCm39) missense probably damaging 0.97
RF006:Inpp4a UTSW 1 37,427,908 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGCAGTGACTCAGAAGACAG -3'
(R):5'- CTGCATACTGCCGAAAATGC -3'

Sequencing Primer
(F):5'- AAGGACATAAGTGTGTGTGCTAGTC -3'
(R):5'- GCATACTGCCGAAAATGCCATATTG -3'
Posted On 2020-09-15