Mutagenetix > Incidental Mutation

Incidental Mutation 'R7920:Dusp27'

648263

Institutional Source

Beutler Lab

Gene Symbol

Dusp27

Ensembl Gene

ENSMUSG00000026564

Gene Name

dual specificity phosphatase 27 (putative)

Synonyms

C130085G02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7920 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

166098148-166127922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 166099896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 716 (N716Y)

Ref Sequence

ENSEMBL: ENSMUSP00000083155 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]

AlphaFold

Q148W8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085992
AA Change: N716Y

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: N716Y

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192369
AA Change: N716Y

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: N716Y

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (63/63)

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024B05Rik	T	C	14: 41,996,173	S9P	probably damaging	Het
AI661453	A	T	17: 47,468,406	Q1019L	unknown	Het
Aldh1a1	T	A	19: 20,617,937	W77R	probably damaging	Het
Cc2d2a	T	C	5: 43,739,309	I1516T	probably benign	Het
Ccdc149	T	A	5: 52,405,094	I197F	probably damaging	Het
Ccdc189	A	G	7: 127,587,953	M46T	probably benign	Het
Cfb	A	G	17: 34,860,891	V176A	probably benign	Het
Chordc1	A	G	9: 18,302,101	K83E	probably benign	Het
Cic	G	A	7: 25,271,959	V372M	probably benign	Het
Coq2	T	A	5: 100,663,875		probably benign	Het
Cradd	A	G	10: 95,322,711	L58P	probably damaging	Het
Crim1	A	T	17: 78,303,064	D316V	probably damaging	Het
Cyb5rl	C	A	4: 107,071,008	L114I	possibly damaging	Het
Cyp2c69	T	G	19: 39,877,803		probably null	Het
Ddhd1	A	G	14: 45,657,470	F181S	probably damaging	Het
Dennd1b	G	A	1: 139,062,873	E192K	probably damaging	Het
Dmrt1	T	C	19: 25,506,019	S56P	possibly damaging	Het
Dnah12	A	G	14: 26,856,542	E3086G	possibly damaging	Het
Dnah5	A	T	15: 28,453,222	M4380L	probably benign	Het
Dph7	A	T	2: 24,971,612	M346L	probably benign	Het
Egf	C	T	3: 129,735,840	R307H	probably benign	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Fcna	T	C	2: 25,626,286	K112E	probably benign	Het
Fkbp5	A	T	17: 28,429,239	N125K	possibly damaging	Het
Foxo3	C	T	10: 42,197,769	V251I	possibly damaging	Het
Fryl	T	A	5: 73,101,807		probably null	Het
Fsip2	A	G	2: 82,951,021	E253G	possibly damaging	Het
Gm49333	A	G	16: 20,637,692	E428G	possibly damaging	Het
Gprc6a	T	A	10: 51,614,930	T908S	probably benign	Het
Grin2c	A	T	11: 115,254,144	F560L	probably benign	Het
Hao1	T	A	2: 134,548,252	N56Y	probably damaging	Het
Haus3	T	C	5: 34,167,702	I204M	probably benign	Het
Htr3b	C	A	9: 48,937,156	C263F	probably damaging	Het
Ica1	A	T	6: 8,742,274	C120S	probably benign	Het
Inpp4a	T	A	1: 37,367,805	S210T	probably benign	Het
Inpp5d	T	G	1: 87,705,949	I699S	probably damaging	Het
Kcng1	A	G	2: 168,262,984	V314A	probably benign	Het
Lcn11	G	A	2: 25,779,331	V167M	possibly damaging	Het
Lingo3	C	A	10: 80,834,548	R516L	probably benign	Het
Lrmda	T	C	14: 22,596,478	V151A	probably damaging	Het
Ly6g5b	A	C	17: 35,114,602	I133R	probably damaging	Het
Mcidas	G	A	13: 112,998,987	G315S	probably damaging	Het
Miip	C	T	4: 147,862,918	G236S	probably benign	Het
Mroh7	T	C	4: 106,707,576	T562A	probably benign	Het
Nlrc4	A	G	17: 74,427,119	M933T	probably benign	Het
Olfr539	A	T	7: 140,667,901	S198C	possibly damaging	Het
Pkhd1	A	T	1: 20,275,535	D2756E	probably damaging	Het
Plekhm2	T	C	4: 141,632,121	D445G	probably damaging	Het
Ppp1r12c	C	T	7: 4,483,355	G605D	probably benign	Het
Pygb	T	A	2: 150,787,002	N45K	possibly damaging	Het
Scn4b	A	G	9: 45,146,771	T54A	probably damaging	Het
Scrt1	T	A	15: 76,519,217	H191L	unknown	Het
Sdc3	A	G	4: 130,819,196	M289V	probably benign	Het
Shb	C	T	4: 45,489,054		probably null	Het
Slc1a5	A	G	7: 16,793,870	T364A	probably damaging	Het
Slc25a27	A	G	17: 43,649,673	V218A	probably benign	Het
Slc39a4	C	T	15: 76,614,085	G384D	probably damaging	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Tmem67	A	T	4: 12,089,284		probably null	Het
Tonsl	C	T	15: 76,634,587	R544H	probably damaging	Het
Trex1	A	G	9: 109,058,089	V278A	unknown	Het
Ttn	A	T	2: 76,795,157	D15107E	probably damaging	Het
Tubgcp5	A	G	7: 55,816,562	T621A	probably benign	Het
Zfhx4	T	C	3: 5,400,455	V1916A	possibly damaging	Het
Zfp260	A	T	7: 30,105,592	K306*	probably null	Het
Zkscan7	A	T	9: 122,895,909	T648S	probably benign	Het
Zscan4c	T	A	7: 11,009,772	F433I	possibly damaging	Het

Other mutations in Dusp27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Dusp27	APN	1	166100552	missense	probably benign	0.00
IGL00973:Dusp27	APN	1	166099458	missense	probably benign
IGL01331:Dusp27	APN	1	166108180	missense	probably damaging	1.00
IGL01466:Dusp27	APN	1	166100504	missense	probably damaging	1.00
IGL01572:Dusp27	APN	1	166100372	missense	probably benign	0.18
IGL01906:Dusp27	APN	1	166099523	missense	probably damaging	1.00
IGL01974:Dusp27	APN	1	166100536	nonsense	probably null
IGL02112:Dusp27	APN	1	166099671	nonsense	probably null
IGL02805:Dusp27	APN	1	166099061	missense	probably damaging	1.00
IGL03343:Dusp27	APN	1	166099448	missense	probably benign	0.00
R0116:Dusp27	UTSW	1	166099701	missense	probably benign	0.19
R0367:Dusp27	UTSW	1	166100763	missense	probably benign	0.05
R0499:Dusp27	UTSW	1	166099101	missense	probably benign	0.00
R0542:Dusp27	UTSW	1	166101284	missense	possibly damaging	0.90
R1312:Dusp27	UTSW	1	166099291	missense	possibly damaging	0.46
R1572:Dusp27	UTSW	1	166099455	missense	possibly damaging	0.68
R1598:Dusp27	UTSW	1	166110259	missense	probably benign	0.10
R1858:Dusp27	UTSW	1	166100846	missense	possibly damaging	0.87
R2021:Dusp27	UTSW	1	166100823	missense	probably benign	0.00
R2970:Dusp27	UTSW	1	166099229	missense	probably benign	0.04
R3727:Dusp27	UTSW	1	166099506	missense	probably damaging	1.00
R4041:Dusp27	UTSW	1	166100111	missense	probably benign	0.01
R4245:Dusp27	UTSW	1	166101116	missense	probably damaging	1.00
R4955:Dusp27	UTSW	1	166108092	missense	probably damaging	1.00
R4967:Dusp27	UTSW	1	166127106	missense	probably damaging	1.00
R5040:Dusp27	UTSW	1	166100345	missense	probably benign	0.17
R5342:Dusp27	UTSW	1	166110250	missense	probably benign	0.01
R5467:Dusp27	UTSW	1	166112030	critical splice donor site	probably null
R5742:Dusp27	UTSW	1	166099454	missense	probably benign	0.00
R6222:Dusp27	UTSW	1	166098645	missense	probably benign	0.26
R6239:Dusp27	UTSW	1	166098819	missense	probably damaging	1.00
R6531:Dusp27	UTSW	1	166110046	splice site	probably null
R6586:Dusp27	UTSW	1	166100885	missense	possibly damaging	0.79
R6958:Dusp27	UTSW	1	166107996	missense	probably damaging	1.00
R7006:Dusp27	UTSW	1	166099094	missense	probably benign
R7111:Dusp27	UTSW	1	166127154	missense	possibly damaging	0.66
R7310:Dusp27	UTSW	1	166098731	missense	possibly damaging	0.46
R7312:Dusp27	UTSW	1	166127107	missense	probably damaging	0.99
R7378:Dusp27	UTSW	1	166112063	nonsense	probably null
R7398:Dusp27	UTSW	1	166100475	missense	probably damaging	1.00
R7442:Dusp27	UTSW	1	166101015	missense	probably benign	0.01
R7569:Dusp27	UTSW	1	166108035	missense	probably damaging	1.00
R7954:Dusp27	UTSW	1	166099280	missense	probably benign	0.05
R7972:Dusp27	UTSW	1	166099139	missense	probably damaging	1.00
R8186:Dusp27	UTSW	1	166100079	missense	probably damaging	1.00
R8354:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8454:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8535:Dusp27	UTSW	1	166101161	missense	probably benign	0.01
R9419:Dusp27	UTSW	1	166100186	missense	probably damaging	1.00
R9493:Dusp27	UTSW	1	166098841	missense	probably damaging	1.00
R9694:Dusp27	UTSW	1	166101085	missense	probably damaging	1.00
Z1088:Dusp27	UTSW	1	166099283	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCACGTTGTCAGCAAAGAG -3'
(R):5'- AGTCAGTCCATGGGAAGCTG -3'

Sequencing Primer
(F):5'- TTCAGCCCTGGAGGTCAG -3'
(R):5'- CTGGGAGGCAGACAGCTCAAC -3'

Posted On

2020-09-15