Incidental Mutation 'R7920:Hao1'
ID648269
Institutional Source Beutler Lab
Gene Symbol Hao1
Ensembl Gene ENSMUSG00000027261
Gene Namehydroxyacid oxidase 1, liver
SynonymsGOX, Gox1, Hao-1
MMRRC Submission
Accession Numbers

Genbank: NM_010403; MGI: 96011

Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7920 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location134497361-134554368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134548252 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 56 (N56Y)
Ref Sequence ENSEMBL: ENSMUSP00000028704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028704]
Predicted Effect probably damaging
Transcript: ENSMUST00000028704
AA Change: N56Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028704
Gene: ENSMUSG00000027261
AA Change: N56Y

DomainStartEndE-ValueType
Pfam:FMN_dh 15 362 9.1e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]
PHENOTYPE: Electrophoretic variants are known for this locus. The a allele determines a fast migrating band in BALB/c, CBA/H, C3H/He and C57BL/6; the b allele, a slow band in NZC; the c allele, the fastest band in DBA/Li, NFS/N, STS, 101/H and 129. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,996,173 S9P probably damaging Het
AI661453 A T 17: 47,468,406 Q1019L unknown Het
Aldh1a1 T A 19: 20,617,937 W77R probably damaging Het
Cc2d2a T C 5: 43,739,309 I1516T probably benign Het
Ccdc149 T A 5: 52,405,094 I197F probably damaging Het
Ccdc189 A G 7: 127,587,953 M46T probably benign Het
Cfb A G 17: 34,860,891 V176A probably benign Het
Chordc1 A G 9: 18,302,101 K83E probably benign Het
Cic G A 7: 25,271,959 V372M probably benign Het
Coq2 T A 5: 100,663,875 probably benign Het
Cradd A G 10: 95,322,711 L58P probably damaging Het
Crim1 A T 17: 78,303,064 D316V probably damaging Het
Cyb5rl C A 4: 107,071,008 L114I possibly damaging Het
Cyp2c69 T G 19: 39,877,803 probably null Het
Ddhd1 A G 14: 45,657,470 F181S probably damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dmrt1 T C 19: 25,506,019 S56P possibly damaging Het
Dnah12 A G 14: 26,856,542 E3086G possibly damaging Het
Dnah5 A T 15: 28,453,222 M4380L probably benign Het
Dph7 A T 2: 24,971,612 M346L probably benign Het
Dusp27 T A 1: 166,099,896 N716Y possibly damaging Het
Egf C T 3: 129,735,840 R307H probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcna T C 2: 25,626,286 K112E probably benign Het
Fkbp5 A T 17: 28,429,239 N125K possibly damaging Het
Foxo3 C T 10: 42,197,769 V251I possibly damaging Het
Fryl T A 5: 73,101,807 probably null Het
Fsip2 A G 2: 82,951,021 E253G possibly damaging Het
Gm49333 A G 16: 20,637,692 E428G possibly damaging Het
Gprc6a T A 10: 51,614,930 T908S probably benign Het
Grin2c A T 11: 115,254,144 F560L probably benign Het
Haus3 T C 5: 34,167,702 I204M probably benign Het
Htr3b C A 9: 48,937,156 C263F probably damaging Het
Ica1 A T 6: 8,742,274 C120S probably benign Het
Inpp4a T A 1: 37,367,805 S210T probably benign Het
Inpp5d T G 1: 87,705,949 I699S probably damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Lcn11 G A 2: 25,779,331 V167M possibly damaging Het
Lingo3 C A 10: 80,834,548 R516L probably benign Het
Lrmda T C 14: 22,596,478 V151A probably damaging Het
Ly6g5b A C 17: 35,114,602 I133R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mroh7 T C 4: 106,707,576 T562A probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Olfr539 A T 7: 140,667,901 S198C possibly damaging Het
Pkhd1 A T 1: 20,275,535 D2756E probably damaging Het
Plekhm2 T C 4: 141,632,121 D445G probably damaging Het
Ppp1r12c C T 7: 4,483,355 G605D probably benign Het
Pygb T A 2: 150,787,002 N45K possibly damaging Het
Scn4b A G 9: 45,146,771 T54A probably damaging Het
Scrt1 T A 15: 76,519,217 H191L unknown Het
Sdc3 A G 4: 130,819,196 M289V probably benign Het
Shb C T 4: 45,489,054 probably null Het
Slc1a5 A G 7: 16,793,870 T364A probably damaging Het
Slc25a27 A G 17: 43,649,673 V218A probably benign Het
Slc39a4 C T 15: 76,614,085 G384D probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Tmem67 A T 4: 12,089,284 probably null Het
Tonsl C T 15: 76,634,587 R544H probably damaging Het
Trex1 A G 9: 109,058,089 V278A unknown Het
Ttn A T 2: 76,795,157 D15107E probably damaging Het
Tubgcp5 A G 7: 55,816,562 T621A probably benign Het
Zfhx4 T C 3: 5,400,455 V1916A possibly damaging Het
Zfp260 A T 7: 30,105,592 K306* probably null Het
Zkscan7 A T 9: 122,895,909 T648S probably benign Het
Zscan4c T A 7: 11,009,772 F433I possibly damaging Het
Other mutations in Hao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hao1 APN 2 134554270 missense probably damaging 0.99
IGL00886:Hao1 APN 2 134523159 missense probably benign 0.00
IGL00954:Hao1 APN 2 134498261 missense possibly damaging 0.87
IGL01472:Hao1 APN 2 134554230 missense probably benign 0.04
IGL01570:Hao1 APN 2 134554200 missense probably damaging 0.97
3-1:Hao1 UTSW 2 134500996 critical splice donor site probably null
R0928:Hao1 UTSW 2 134505616 missense possibly damaging 0.54
R0948:Hao1 UTSW 2 134530773 missense probably damaging 1.00
R1204:Hao1 UTSW 2 134523027 nonsense probably null
R1748:Hao1 UTSW 2 134498318 missense possibly damaging 0.67
R1827:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1828:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1917:Hao1 UTSW 2 134523060 missense probably benign 0.02
R2054:Hao1 UTSW 2 134498258 synonymous silent
R2070:Hao1 UTSW 2 134530615 missense probably damaging 1.00
R3831:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3833:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3960:Hao1 UTSW 2 134522983 critical splice donor site probably null
R4509:Hao1 UTSW 2 134523044 missense probably damaging 0.99
R4635:Hao1 UTSW 2 134523152 missense probably damaging 1.00
R4662:Hao1 UTSW 2 134523027 nonsense probably null
R4716:Hao1 UTSW 2 134505620 missense probably damaging 1.00
R6161:Hao1 UTSW 2 134505625 missense probably benign 0.06
R6374:Hao1 UTSW 2 134523104 missense probably benign 0.14
R6799:Hao1 UTSW 2 134530765 missense probably damaging 1.00
R6876:Hao1 UTSW 2 134501149 missense probably benign 0.00
R7305:Hao1 UTSW 2 134548201 missense probably benign 0.00
R7554:Hao1 UTSW 2 134530618 missense possibly damaging 0.78
R7585:Hao1 UTSW 2 134501156 missense probably damaging 1.00
R8528:Hao1 UTSW 2 134522993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGGAAGGGTGTTCGAG -3'
(R):5'- TCTTACAGAAGGAAGGTCCATACC -3'

Sequencing Primer
(F):5'- CGAGAAGGAAGCCTCTCTTTGTC -3'
(R):5'- AGGCTGTCTACTGTAGGAATCCATC -3'
Posted On2020-09-15