Incidental Mutation 'R0023:Gas6'
ID64827
Institutional Source Beutler Lab
Gene Symbol Gas6
Ensembl Gene ENSMUSG00000031451
Gene Namegrowth arrest specific 6
Synonymsgrowth arrest-specific, Gas-6, GAS 6
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0023 (G1)
Quality Score97
Status Validated
Chromosome8
Chromosomal Location13465374-13494490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13470344 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 448 (L448R)
Ref Sequence ENSEMBL: ENSMUSP00000033828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033828]
Predicted Effect probably damaging
Transcript: ENSMUST00000033828
AA Change: L448R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033828
Gene: ENSMUSG00000031451
AA Change: L448R

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
GLA 26 90 6.66e-30 SMART
EGF 116 151 3.97e0 SMART
EGF_CA 153 193 3.1e-11 SMART
EGF_CA 194 234 1.91e-11 SMART
EGF_CA 235 275 1.25e-6 SMART
LamG 314 450 2.71e-24 SMART
LamG 502 647 1.27e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211356
Meta Mutation Damage Score 0.5492 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-carboxyglutamic acid (Gla)-containing protein thought to be involved in the stimulation of cell proliferation. This gene is frequently overexpressed in many cancers and has been implicated as an adverse prognostic marker. Elevated protein levels are additionally associated with a variety of disease states, including venous thromboembolic disease, systemic lupus erythematosus, chronic renal failure, and preeclampsia. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice are protected against arterial and venous thrombosis, and though platelet aggregation is impaired, spontaneous or excess trauma-induced bleeding is not observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Gas6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Gas6 APN 8 13476171 missense probably damaging 0.99
IGL01100:Gas6 APN 8 13475118 missense probably benign 0.27
IGL02014:Gas6 APN 8 13468359 missense possibly damaging 0.59
IGL02931:Gas6 APN 8 13477136 missense probably damaging 0.98
R0497:Gas6 UTSW 8 13470387 missense possibly damaging 0.86
R1126:Gas6 UTSW 8 13483700 missense probably benign 0.02
R1597:Gas6 UTSW 8 13493901 missense probably damaging 1.00
R1601:Gas6 UTSW 8 13465786 missense probably damaging 1.00
R1643:Gas6 UTSW 8 13465902 critical splice acceptor site probably null
R1914:Gas6 UTSW 8 13477152 missense probably benign
R1967:Gas6 UTSW 8 13470317 missense probably damaging 0.98
R2012:Gas6 UTSW 8 13468266 missense probably damaging 1.00
R4663:Gas6 UTSW 8 13470254 missense probably damaging 1.00
R4723:Gas6 UTSW 8 13466848 missense probably damaging 0.99
R4750:Gas6 UTSW 8 13476227 missense probably benign 0.29
R4869:Gas6 UTSW 8 13475086 missense possibly damaging 0.55
R5558:Gas6 UTSW 8 13466764 missense probably null 0.03
R5706:Gas6 UTSW 8 13477098 missense probably damaging 0.98
R5791:Gas6 UTSW 8 13470217 critical splice donor site probably null
R6767:Gas6 UTSW 8 13465784 missense probably damaging 0.98
R6825:Gas6 UTSW 8 13483674 missense probably benign 0.00
R7374:Gas6 UTSW 8 13474802 missense probably damaging 0.99
R7419:Gas6 UTSW 8 13471456 missense probably benign 0.19
R7588:Gas6 UTSW 8 13466711 missense probably benign 0.03
R7810:Gas6 UTSW 8 13466809 missense probably damaging 1.00
X0063:Gas6 UTSW 8 13471538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACTGGTACTCACGGAGACAGG -3'
(R):5'- CGTAAGCATGTGGTTAAGCTGGGAC -3'

Sequencing Primer
(F):5'- ATGGATCTTATACTTCAGCCTACAGC -3'
(R):5'- CTTACACAGTCAGGTGGCAG -3'
Posted On2013-08-06