Incidental Mutation 'R7920:Pygb'
ID 648270
Institutional Source Beutler Lab
Gene Symbol Pygb
Ensembl Gene ENSMUSG00000033059
Gene Name brain glycogen phosphorylase
Synonyms
MMRRC Submission 045967-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.236) question?
Stock # R7920 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 150628716-150673668 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150628922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 45 (N45K)
Ref Sequence ENSEMBL: ENSMUSP00000035743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045441]
AlphaFold Q8CI94
Predicted Effect possibly damaging
Transcript: ENSMUST00000045441
AA Change: N45K

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035743
Gene: ENSMUSG00000033059
AA Change: N45K

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen phosphorylase found predominantly in the brain. The encoded protein forms homodimers which can associate into homotetramers, the enzymatically active form of glycogen phosphorylase. The activity of this enzyme is positively regulated by AMP and negatively regulated by ATP, ADP, and glucose-6-phosphate. This enzyme catalyzes the rate-determining step in glycogen degradation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,818,130 (GRCm39) S9P probably damaging Het
AI661453 A T 17: 47,779,331 (GRCm39) Q1019L unknown Het
Aldh1a1 T A 19: 20,595,301 (GRCm39) W77R probably damaging Het
Cc2d2a T C 5: 43,896,651 (GRCm39) I1516T probably benign Het
Ccdc149 T A 5: 52,562,436 (GRCm39) I197F probably damaging Het
Cfap119 A G 7: 127,187,125 (GRCm39) M46T probably benign Het
Cfb A G 17: 35,079,867 (GRCm39) V176A probably benign Het
Chordc1 A G 9: 18,213,397 (GRCm39) K83E probably benign Het
Cic G A 7: 24,971,384 (GRCm39) V372M probably benign Het
Coq2 T A 5: 100,811,741 (GRCm39) probably benign Het
Cradd A G 10: 95,158,573 (GRCm39) L58P probably damaging Het
Crim1 A T 17: 78,610,493 (GRCm39) D316V probably damaging Het
Cyb5rl C A 4: 106,928,205 (GRCm39) L114I possibly damaging Het
Cyp2c69 T G 19: 39,866,247 (GRCm39) probably null Het
Ddhd1 A G 14: 45,894,927 (GRCm39) F181S probably damaging Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dmrt1 T C 19: 25,483,383 (GRCm39) S56P possibly damaging Het
Dnah12 A G 14: 26,578,499 (GRCm39) E3086G possibly damaging Het
Dnah5 A T 15: 28,453,368 (GRCm39) M4380L probably benign Het
Dph7 A T 2: 24,861,624 (GRCm39) M346L probably benign Het
Eef1ece2 A G 16: 20,456,442 (GRCm39) E428G possibly damaging Het
Egf C T 3: 129,529,489 (GRCm39) R307H probably benign Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Fcna T C 2: 25,516,298 (GRCm39) K112E probably benign Het
Fkbp5 A T 17: 28,648,213 (GRCm39) N125K possibly damaging Het
Foxo3 C T 10: 42,073,765 (GRCm39) V251I possibly damaging Het
Fryl T A 5: 73,259,150 (GRCm39) probably null Het
Fsip2 A G 2: 82,781,365 (GRCm39) E253G possibly damaging Het
Gprc6a T A 10: 51,491,026 (GRCm39) T908S probably benign Het
Grin2c A T 11: 115,144,970 (GRCm39) F560L probably benign Het
Hao1 T A 2: 134,390,172 (GRCm39) N56Y probably damaging Het
Haus3 T C 5: 34,325,046 (GRCm39) I204M probably benign Het
Htr3b C A 9: 48,848,456 (GRCm39) C263F probably damaging Het
Ica1 A T 6: 8,742,274 (GRCm39) C120S probably benign Het
Inpp4a T A 1: 37,406,886 (GRCm39) S210T probably benign Het
Inpp5d T G 1: 87,633,671 (GRCm39) I699S probably damaging Het
Kcng1 A G 2: 168,104,904 (GRCm39) V314A probably benign Het
Lcn11 G A 2: 25,669,343 (GRCm39) V167M possibly damaging Het
Lingo3 C A 10: 80,670,382 (GRCm39) R516L probably benign Het
Lrmda T C 14: 22,646,546 (GRCm39) V151A probably damaging Het
Ly6g5b A C 17: 35,333,578 (GRCm39) I133R probably damaging Het
Mcidas G A 13: 113,135,521 (GRCm39) G315S probably damaging Het
Miip C T 4: 147,947,375 (GRCm39) G236S probably benign Het
Mroh7 T C 4: 106,564,773 (GRCm39) T562A probably benign Het
Nlrc4 A G 17: 74,734,114 (GRCm39) M933T probably benign Het
Or13a25 A T 7: 140,247,814 (GRCm39) S198C possibly damaging Het
Pkhd1 A T 1: 20,345,759 (GRCm39) D2756E probably damaging Het
Plekhm2 T C 4: 141,359,432 (GRCm39) D445G probably damaging Het
Ppp1r12c C T 7: 4,486,354 (GRCm39) G605D probably benign Het
Scn4b A G 9: 45,058,069 (GRCm39) T54A probably damaging Het
Scrt1 T A 15: 76,403,417 (GRCm39) H191L unknown Het
Sdc3 A G 4: 130,546,507 (GRCm39) M289V probably benign Het
Shb C T 4: 45,489,054 (GRCm39) probably null Het
Slc1a5 A G 7: 16,527,795 (GRCm39) T364A probably damaging Het
Slc25a27 A G 17: 43,960,564 (GRCm39) V218A probably benign Het
Slc39a4 C T 15: 76,498,285 (GRCm39) G384D probably damaging Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Styxl2 T A 1: 165,927,465 (GRCm39) N716Y possibly damaging Het
Tmem67 A T 4: 12,089,284 (GRCm39) probably null Het
Tonsl C T 15: 76,518,787 (GRCm39) R544H probably damaging Het
Trex1 A G 9: 108,887,157 (GRCm39) V278A unknown Het
Ttn A T 2: 76,625,501 (GRCm39) D15107E probably damaging Het
Tubgcp5 A G 7: 55,466,310 (GRCm39) T621A probably benign Het
Zfhx4 T C 3: 5,465,515 (GRCm39) V1916A possibly damaging Het
Zfp260 A T 7: 29,805,017 (GRCm39) K306* probably null Het
Zkscan7 A T 9: 122,724,974 (GRCm39) T648S probably benign Het
Zscan4c T A 7: 10,743,699 (GRCm39) F433I possibly damaging Het
Other mutations in Pygb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Pygb APN 2 150,661,833 (GRCm39) missense probably benign 0.00
IGL01395:Pygb APN 2 150,643,503 (GRCm39) missense probably benign 0.04
IGL01571:Pygb APN 2 150,672,393 (GRCm39) missense probably benign 0.00
IGL01960:Pygb APN 2 150,655,403 (GRCm39) missense probably benign 0.00
IGL03118:Pygb APN 2 150,662,731 (GRCm39) missense probably benign 0.01
R0106:Pygb UTSW 2 150,648,123 (GRCm39) missense probably benign 0.02
R0106:Pygb UTSW 2 150,648,123 (GRCm39) missense probably benign 0.02
R0423:Pygb UTSW 2 150,665,904 (GRCm39) missense probably benign
R0545:Pygb UTSW 2 150,657,626 (GRCm39) missense probably benign 0.00
R0674:Pygb UTSW 2 150,657,054 (GRCm39) splice site probably null
R1052:Pygb UTSW 2 150,628,858 (GRCm39) missense probably benign 0.00
R1590:Pygb UTSW 2 150,659,583 (GRCm39) missense possibly damaging 0.94
R1706:Pygb UTSW 2 150,669,067 (GRCm39) missense probably damaging 1.00
R1786:Pygb UTSW 2 150,658,692 (GRCm39) missense probably damaging 0.98
R2405:Pygb UTSW 2 150,662,695 (GRCm39) missense probably benign 0.04
R3522:Pygb UTSW 2 150,670,473 (GRCm39) missense probably benign 0.07
R4082:Pygb UTSW 2 150,668,391 (GRCm39) critical splice donor site probably null
R4319:Pygb UTSW 2 150,657,534 (GRCm39) splice site probably benign
R4662:Pygb UTSW 2 150,657,036 (GRCm39) missense probably benign
R5072:Pygb UTSW 2 150,643,498 (GRCm39) missense probably damaging 1.00
R5665:Pygb UTSW 2 150,662,808 (GRCm39) splice site probably null
R5874:Pygb UTSW 2 150,628,798 (GRCm39) missense probably benign 0.11
R5910:Pygb UTSW 2 150,657,620 (GRCm39) missense probably benign 0.00
R6610:Pygb UTSW 2 150,665,886 (GRCm39) splice site probably null
R6820:Pygb UTSW 2 150,658,674 (GRCm39) missense possibly damaging 0.88
R7348:Pygb UTSW 2 150,628,903 (GRCm39) missense probably benign 0.10
R7936:Pygb UTSW 2 150,657,589 (GRCm39) missense probably benign 0.28
R9226:Pygb UTSW 2 150,662,781 (GRCm39) missense possibly damaging 0.58
R9308:Pygb UTSW 2 150,668,297 (GRCm39) missense probably benign 0.15
R9618:Pygb UTSW 2 150,657,008 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATCCCAGCGCTAGAGTCTTC -3'
(R):5'- CTCTTCATTGGTCGCAGGTGAC -3'

Sequencing Primer
(F):5'- TCTCTGCTCGCTCCAGGG -3'
(R):5'- CATAGTAATGCTGCTGCG -3'
Posted On 2020-09-15