Incidental Mutation 'R7920:Plekhm2'
ID648279
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7920 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141632121 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 445 (D445G)
Ref Sequence ENSEMBL: ENSMUSP00000030751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]
Predicted Effect probably damaging
Transcript: ENSMUST00000030751
AA Change: D445G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: D445G

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000084203
AA Change: D465G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: D465G

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,996,173 S9P probably damaging Het
AI661453 A T 17: 47,468,406 Q1019L unknown Het
Aldh1a1 T A 19: 20,617,937 W77R probably damaging Het
Cc2d2a T C 5: 43,739,309 I1516T probably benign Het
Ccdc149 T A 5: 52,405,094 I197F probably damaging Het
Ccdc189 A G 7: 127,587,953 M46T probably benign Het
Cfb A G 17: 34,860,891 V176A probably benign Het
Chordc1 A G 9: 18,302,101 K83E probably benign Het
Cic G A 7: 25,271,959 V372M probably benign Het
Coq2 T A 5: 100,663,875 probably benign Het
Cradd A G 10: 95,322,711 L58P probably damaging Het
Crim1 A T 17: 78,303,064 D316V probably damaging Het
Cyb5rl C A 4: 107,071,008 L114I possibly damaging Het
Cyp2c69 T G 19: 39,877,803 probably null Het
Ddhd1 A G 14: 45,657,470 F181S probably damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dmrt1 T C 19: 25,506,019 S56P possibly damaging Het
Dnah12 A G 14: 26,856,542 E3086G possibly damaging Het
Dnah5 A T 15: 28,453,222 M4380L probably benign Het
Dph7 A T 2: 24,971,612 M346L probably benign Het
Dusp27 T A 1: 166,099,896 N716Y possibly damaging Het
Egf C T 3: 129,735,840 R307H probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcna T C 2: 25,626,286 K112E probably benign Het
Fkbp5 A T 17: 28,429,239 N125K possibly damaging Het
Foxo3 C T 10: 42,197,769 V251I possibly damaging Het
Fryl T A 5: 73,101,807 probably null Het
Fsip2 A G 2: 82,951,021 E253G possibly damaging Het
Gm49333 A G 16: 20,637,692 E428G possibly damaging Het
Gprc6a T A 10: 51,614,930 T908S probably benign Het
Grin2c A T 11: 115,254,144 F560L probably benign Het
Hao1 T A 2: 134,548,252 N56Y probably damaging Het
Haus3 T C 5: 34,167,702 I204M probably benign Het
Htr3b C A 9: 48,937,156 C263F probably damaging Het
Ica1 A T 6: 8,742,274 C120S probably benign Het
Inpp4a T A 1: 37,367,805 S210T probably benign Het
Inpp5d T G 1: 87,705,949 I699S probably damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Lcn11 G A 2: 25,779,331 V167M possibly damaging Het
Lingo3 C A 10: 80,834,548 R516L probably benign Het
Lrmda T C 14: 22,596,478 V151A probably damaging Het
Ly6g5b A C 17: 35,114,602 I133R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mroh7 T C 4: 106,707,576 T562A probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Olfr539 A T 7: 140,667,901 S198C possibly damaging Het
Pkhd1 A T 1: 20,275,535 D2756E probably damaging Het
Ppp1r12c C T 7: 4,483,355 G605D probably benign Het
Pygb T A 2: 150,787,002 N45K possibly damaging Het
Scn4b A G 9: 45,146,771 T54A probably damaging Het
Scrt1 T A 15: 76,519,217 H191L unknown Het
Sdc3 A G 4: 130,819,196 M289V probably benign Het
Shb C T 4: 45,489,054 probably null Het
Slc1a5 A G 7: 16,793,870 T364A probably damaging Het
Slc25a27 A G 17: 43,649,673 V218A probably benign Het
Slc39a4 C T 15: 76,614,085 G384D probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Tmem67 A T 4: 12,089,284 probably null Het
Tonsl C T 15: 76,634,587 R544H probably damaging Het
Trex1 A G 9: 109,058,089 V278A unknown Het
Ttn A T 2: 76,795,157 D15107E probably damaging Het
Tubgcp5 A G 7: 55,816,562 T621A probably benign Het
Zfhx4 T C 3: 5,400,455 V1916A possibly damaging Het
Zfp260 A T 7: 30,105,592 K306* probably null Het
Zkscan7 A T 9: 122,895,909 T648S probably benign Het
Zscan4c T A 7: 11,009,772 F433I possibly damaging Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141627854 missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141634347 missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141632374 missense probably benign
R2261:Plekhm2 UTSW 4 141642732 missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141642005 missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6367:Plekhm2 UTSW 4 141639705 missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141642459 missense possibly damaging 0.91
R7399:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141631347 missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
R8417:Plekhm2 UTSW 4 141627825 missense probably benign 0.04
R8504:Plekhm2 UTSW 4 141642453 missense probably damaging 1.00
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141629085 missense possibly damaging 0.77
Z1177:Plekhm2 UTSW 4 141639822 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGAGCTTGCAAAGAGCCTC -3'
(R):5'- TAGGACAGCCTCTGAGCAAG -3'

Sequencing Primer
(F):5'- AAAGAGCCTCGTGGGTTCCAG -3'
(R):5'- AGCCTCTGAGCAAGGTCATTGAC -3'
Posted On2020-09-15